ABX  Part 1
by Marknew
Cosmic Energy, Genetic Therapy -- what more does a woman need?


1

Far back in the history of the universe, mere moments after the Big Bang,
matter is forming from the void, spilling and flowing, clustering and
clumping, each clump exploding in bursts of energy and light, shock waves
rippling through unknown and unknowing pre-atomic particles, creating billions
of new forms of matter each millisecond. New kinds of matter. New kinds of
energy. Creation, extinction, absorption, combination. A becomes B becomes C
becomes DEFABC, which becomes DE GA and R2D2. GA becomes GTCA, then GATACA,
but then, sadly, dies. AB becomes ABX, which grows and grows.

ABXGAGADM%3POGDY.

Everything is possible. Everything is changing. ABX is in everything.
Everything is ABX.

They are exciting times.

Will tumult continue forever? Will the universe ever settle down?

Nothing is stable. Everything cools, separates, dissipates.

Nothing survives but matter and energy.

Almost nothing.

We all know the answer.

Don't we?

We are the answer.

2

Electrons, positrons, quarks and neutrinos.

Matter and energy.

Stars and voids.

The hydrogen atoms float dumbly through space, weak forces and strong forces
gather them together. Dumbly. Mass concentrates too much for stable space. It
collapses into itself, warping time, warping space.

Black holes.

Two black holes.

Drawn to each other, not belonging. Event horizons crash and merge. Shock
waves ripple through the particle filled space. Creation again! If only for an
instant. A becomes B becomes X becomes ABX.

Cosmic ray ABX reborn! It hurtles through space.

Remember the good old days?

It's not the same. Cosmic ray ABX survives, hurtling through space, alone.
Hitting nothing. Becoming nothing more.

There are no others. Nothing but dumb matter and dumb energy.

3

15 billion years pass.

She is twelve, her body beginning to change. Exciting, frightening, beyond her
control. She looks at herself everyday, marking the new, gentle curves, aware
of the new sensitivity in parts of her body, suddenly invested with special
meaning, special dangers.

Others notice too. Boys are looking at her, staring at her chest, peering down
her shirt when she bends down, bumping into her in the hallway. "Elbow
titting" they call it, tittering, whispering. As if she didn't know what it
was. But why oh why do they have to do it? It hurts, and it's so ... jerky!

But what can she do? Her friends, former friends really, have no sympathy.
They act as though her more advanced maturity is some kind of fancy present
she's been given and refuses to share. But it's not! It's a burden, not a
gift. Why don't they understand? Why are they being so stupid? They act like
she has nothing to complain about. But she does!! She hurts a lot. She feels
clumsy. Her clothes don't fit right. She can't walk normally, stand normally.
Everything is more complicated. Can't they understand?! Why can't they still
be friends?

And then there's the men. It makes her shiver, the way they look at her. It's
bad enough when the ninth graders do it, but when her teachers look at her,
when their practiced eyes, rove across her chest it feels almost like their
creepy fingers are touching her, and then she wants to run to the girls'
bathroom and throw up her lunch, and then to stay there all afternoon, until
all the men have left. But what if they didn't leave? What if everyone else
had left, and they were still there, waiting, waiting for her to come out so
that they could look at her again, glance at each other, nodding, smirking,
knowing what was underneath her clothing, knowing far better than she knew
herself what it all meant.

Oh God!

She runs to the bathroom and throws up. Again. The fifth day in a row!

Maybe if she throws up every day they will stop growing and instead she would
get thinner and thinner, until they go away completely, so that there is
nothing for them all to look at. And then she can be just like her friends
again. And everything can be just the way it used to be. When she was happy to
be just like everyone else.

4

Four years later.

"You're looking very pretty tonight, dear. You're going to have a wonderful
time with Brett, I know."

"I hope so, Mom. You keep saying how nice he seems."

"His mother and I were such good friends when we were in school together,
although I hadn't seen her for years before she moved back to town after her
divorce. And he is very well-spoken, for a boy his age." Her daughter rolls
her eyes. "Now don't be sarcastic with him. You're always so critical of
everyone. Be positive, for once."

"Yes, Mom. I'll try." In response to another sharp look she added, "I
promise."

"And don't spend too much time in the bathroom. It's rude and really quite
disgus...."

"-- Mom, I told you I stopped that last year. I mean mostly I have."

"Exactly, dear. I know you're trying, and it's extra important that you try
hard tonight. You see, now that you've put some weight back on, your figure is
developing again. Boys will find you so attractive, if only you would take
care of yourself -- and give them a chance!" She looks at her daughter
critically. "Now don't give me that expression. I don't want to hear you tell
me that you don't want to be attractive."

"No, Mom. Of course not," she says softly. "Girls should make themselves as
attractive to boys as they can be," she says, somewhat mechanically. "That's
what makes them a real woman."

"Exactly. Which doesn't mean you have to do whatever a boy tells you to do.
Boys can be difficult to handle when they become aroused. You need to be firm
with them so they know when to stop. Boys have to know you have your limits
and if you respect yourself they will respect you and your limits. Is that
clear?"

"Yes, Mom. I know."

"Good! I'm so glad we can talk about these things together, dear. It makes a
mother feel so much more confident."

Later that evening ....

"Where are we going? I thought you were taking me home."

"This is a shortcut."

"No it's not. You missed the turn at --

Brett winks, puts his finger to his lips and then slows the car and pulls off
the road. She looks nervous. "Aww, c'mon. We're having a good time, aren't we?
You liked dinner, and the movie, right?"

"Well ... it was an interesting movie," she starts, trying to get a
conversation going. "Um, but don't you think it was silly that he kept
rescuing her. She was a secret agent too, fully trained, right?"

"Sure but she's a girl! She needs protecting."

"I don't know about that. I mean, what would be the point of having her along
if she just becomes a problem for him, a distraction. I think --

"I think you're forgetting it's just a movie." He has turned off the motor now
and puts his arm around her, leaning over.

"But it's important. If the only consequence of having the girl around is so
that the other agent can protect her --

"So, you're, uh, saying that girls don't need protecting?" he says,
interrupting, leaning away slightly.

"Well ... yes!"

"That girls don't need any special favors."

"Absolutely!"

"That they can take care of themselves just as well as boys."

"That's right!"

Brett nods. "And that basically, anyway, we're all pretty much the same, girls
and guys. We all just want the same things."

"Um ...." she hesitates, suddenly suspicious. "Yeah, pretty much."

Brett grins broadly. "You know, I like your attitude. I thought for a minute
you were one of those stuck-up feminist types, but you're not," he said,
looking directly at her breasts. "You're just one of the guys."

"Yeah, well thanks, but ...," she says nervously.

"Just one of the guys," he repeated, putting his hand on top of her breast and
squeezing a little, "but softer ... curvier ...."

"Hey, wait!" she protests, twisting her body away, but she is confined by the
seat and the door of the small car. She puts her hand on his wrist to try,
unsuccessfully, to pull it off.

"... yes, MUCH curvier, cuter, but definitely WEAKer," he said, triumphantly,
pulling her arm away easily with his free hand while his other squeezes her
tit.

"Stop!" she cries out in frustration. "You're HURTING me, and I don't WANT you
to DO this!" she complains, starting to cry.

"Whinier, more emotional. Hey, just like a GIRL!" he exclaims, shoving his
hand inside her shirt and feeling around her chest, peeling her bra away. "I
THOUGHT you had some big ones!"

"No! Stop. Please stop!" she says between sobs. "Take me home!"

He is pushing against her now. "Suck it. Suck me off," he demands. She put her
hand on his belt buckle and clumsily tries to undo it, but she is too upset to
manage. Frustrated, he pushes her hand away and does it himself and then pulls
out his large, stiff member, which stiffens and hardens even more once freed
from its constraints. "Yeah, is that a fucking monster or what?" he says
proudly.

She shudders at the sight of the purple throbbing mass twitching insistently
in front of her. It looks like an animal, a snake, but not coiled. No, more
like a rod, to beat her with, or worse, if she didn't do something quickly. Is
this what she is supposed to do, to keep boys from being even meaner? "Hey,
c'mon. Get to it already, slut. Yeah. Yeah. That's it. That's right. That's
what girls are for. Yeah. Oh yeah."

5

She looks down from the window of her new dorm room. So many people on the
quad, collected in group of threes, fours and fives. Some are paired off
already. Everyone seems to know at least one person. At least one more than
she does. Had she done the wrong thing coming here? She had wanted so badly to
get away from everyone she had known in high school, but this seems even
worse. You wouldn't think Kansas is so different from Southern Illinois, would
you? Yet it feels like she has landed in a different universe. They all seem
to know where they were going, who their friends will be, what to study
(farming, accounting, business) and what not to (English, psychology,
history). They are all so superficial, so plain. She doesn't fit in. She never
will. No matter how pretty she might be -- oh, she knows boys, and some girls,
find her pretty, but what does it matter? Her head goes in too many different
directions. No one will ever know-- or more importantly, like -- the real her.
No one will care to find out. Being here is all a terrible mistake. She stares
out the window, lost in her misery.

"Hey. Hey! Pretty, sad-face girl! Hey!!"

She looks down. A cute, golden-haired boy is waving at her. She is discovered.
She wants to disappear back into her room, but that will be too rude. She
looks at him wordlessly. She likes his nose. It's round but it doesn't
disappear into his face.

"Hey! Hi!"

She has to smile. He's so friendly. And simple.

"Hey, you want to have dinner with me?"

She looks down at him. "I don't know. Where? The dining room cafeteria?"

"God, no! The Cat's Dog. It's pretty good. For around here." She must have
made a face, because he adds, "Yeah, it can get pretty bleak all alone here,
way out in the prairie."

She looks at her room. It is so depressing, and being alone in the cafeteria
with other freshman she doesn't know is much worse. "OK. I'll come down in a
minute." She quickly brushes on some makeup, brushes her hair, changes her top
twice and then hops down the stairs. He is leaning on a tree, chatting with
two slightly overweight girls, sophomores, she guesses. They look down at her,
a mere freshman knowing nothing. They wink at each other, laugh and move on.

"Sorry about that. I think her name is Jennifer. She's kind of rude, probably
a lesbian."

She is shocked. "Really? How can you tell?"

He smiles suggestively. "Just a feeling. I mean, didn't you see the way she
looked at you?"

"She looked like she didn't approve of me."

"Ha! Well, you're with me, right?" He takes her arm. "But I think she's hot
for you. Anyway, we've talked that question to death already. Boring! On to
The Cat. I'm Mike, by the way. And you're ...."

She is looking behind, curious. A girl with the hots for me? She shivers and
clutches Mike's arm more tightly.

"Hey, don't worry. She won't bite you. At least not with me around!! So, you
adjusting to life away from home? Miss your boyfriend?"

She drops his arm. "Fine. I'm doing fine."

"Sure. But I'd guess if you're not missing someone or someplace, then sad
pretty girl's got some kind of heavy weight on her pretty head, and Mike is
just the fellow who can take it off."

She laughs nervously. "Oh? Well how will you do that?"

"Simple," he replies, his hand resting lightly on her back. "Good food,
pleasant conversation, a sympathetic ear and then a friendly, kind, kiss good
night. You'll see, I'm sure, it's just what the doctor ordered."

She exhales quickly in relief at his easy-going reply. "Well! I, er, you
might, er, be right." Then she blushes. Is she too obvious?

They are now back on campus, close to Mike's room. "That was nice, really
nice, Mike. Thanks for dinner. Thanks so much."

"Oh. That's ok. I enjoyed it too."

"And the people at the restaurant were so nice too."

"Yeah. Well, I've always found that when you treat people nicely they do
notice and respond." His hand, which has been draped over her shoulder drops
down onto her breast and his fingers brush against it and then curl lightly on
top of it. She takes his hand off it, and they keep walking. "Of course,
everybody has their own way of responding, and I understand that. Some people,
who've just started in a new place, may not understand how things work. They
may have trouble making friends, without knowing why. They may need a bit of
help getting settled. You know what I mean?" He stops. She waits for him to
continue. "Do you want to come up for some coffee?"

"Um, couldn't we just stay here? It's nice out, isn't it?"

He seems to shiver. "It's a little cold. I just have this thin shirt. So ...
I'm going in. You coming?"

"OK. I guess." Reluctantly she follows him in. Is she allowed in his dorm
room?

It's a large room. "My roommate, Chad, is in the library. He's always there
until it closes." He opens two beers and hands her one.

She shakes her head. "You said coffee?"

He shrugs. "Guess I'm all out of java."

He takes a big gulp, puts the glasses on the desk and sits on the bed. He pats
the space next to him. There is nowhere else to sit. He looks up at her
beseechingly. He's nothing like Brett or the other boys at home. He seems so
understanding and gentle, almost a little simple. And she likes his fair hair
and round, open face. She sits down a foot away, but on the soft bed his
greater weight immediately makes her start tipping toward him. He puts his arm
around her and laughs. She laughs too. It's an accident. But he doesn't let
go. His fingers close around her shoulder. "You're such a pretty girl. You
should get out more. You shouldn't be sad." He gently touches her face. "Come
on, let's see how you look with a smile."

She's not feeling like smiling now. She tries to pull away, but she can't.

"Hey, what are you doing? We're just sitting together, right?

"I'm not ready."

"Well, you know how to get ready, don't you? Come on. You're not a little girl
anymore. It's time to grow up. You're in college. You don't come home to mommy
and daddy at night. You go out to dinner in restaurants, like an adult,
right?"

She's trying harder to get up but he holds her down. His hand drops down to
her breast and he squeezes it, not gently. "Please. I don't want you to do
that."

"I don't want you to," he parrots. "Jesus! What IS WRONG with you! You go out
on a date. You let me pay for you. You share your 'feelings' with me and I try
to help. And then you look at me with those big eyes all evening, shake your
boobs at me, brush up against me when we're walking back. You get ME all
aroused and then you whine ' I don't want you to'? What kind of child-girl ARE
you pretending to be? Do you want to be an adult college student or are you
planning to run back home to start high school again?"

"No! But ... it's just that I'm not ready for ... for doing this with you. I
mean, I don't know what kind of relationship we have. I just met you. I don't
know if we ought to be having a, you know, a physical relationship. Can't we
just get to know each other better first?" she pleads.

Mike rolls his eyes. "What do you think this IS? A
shake-hands-kiss-at-the-door kind of place? I'm an adult, mature man with real
needs. Don't you understand that? Do you want to be a part of things here, or
do you WANT to stay in your little room for the next four years and stare out
the window watching other people growing up and living real lives?"

"I didn't mean ... if I made you ... uncomfortable ... I'm not, you know, that
innocent. If I ... would it help if I helped you ... masturbate?" she suggests
awkwardly.

"A hand job? Is that what you think makes a man happy? Did your mother teach
you this, or is this something you came up with yourself?"

She doesn't answer. He isn't being nice now at all. What is she doing wrong?
What does she always do wrong? He unbuckles his pants and pulls out his dick.
It's quite a bit smaller than Brett's.

"You have SO much to learn, you know that?"

She nods meekly.

"Do you want me to ... suck it?" she asks in a small voice.

He sighs. "We're getting somewhere, at last," he declares.

She bends down over his lap. The taste of his organ nearly makes her gag but
that passes quickly and she starts on her task, trying not to notice the hands
pawing her breasts, at times painfully. He fits easily in her mouth even when
he becomes fully hard. That makes it a little easier, but it still disgusts
her. Not wanting to gag -- or worse-- she puts it out of her mind. How long
will this take? What can she do to speed him up? Almost before she can start
trying his body stiffens and a few hot drops tickle the roof of her mouth and
then slither down her throat. Now she can leave. Soon she can throw up. And no
one will ever make her leave her room again.

6

Two years pass.

On a farm in Kansas a field of rich soil, moist, fertilized, smelling of fresh
earth, pregnant with grains of wheat waiting to sprout. Each grain like its
neighbour. Agribusiness monoculture in the breadbasket. For the bread basket.

Above the plane of the solar system, the cosmic ray ABX streaks downward
through empty space. Down toward Earth. Through the atmosphere. Toward Kansas
and its empty space. Until it hits one grain, one lucky grain. And stops. ABX.
DNA. GATTCATTACATATCA.

GATTCACABXGATTACATACABX.

7

A few months pass. The wheat stirs in the wind. Stalk after stalk in row after
row. Agribusiness monoculture.

Almost a monoculture. The subtle genetic variation of each plant unnoticeable
to the human eye, rarely expressing itself in any useful way, rarely surviving
to the next generation, thanks to the technology of seed bank genetic
manipulation.

GATTCACABXGATTACATACABXTACCAGACTAAGGABXABXABXGATTCCCGATA.

One plant stands nearly twice as high as its neighbors, whose root systems are
starved of water, strangled by one plant's startlingly aggressive growth, its
genes having long ago mastered tricks of solar energy conversion far more
sophisticated than chlorophyll and having more recently found the genetic
material of its neighbors floating in the air, replicated their marginal
advantages of growth, disease resistance, nutrient absorption and hardiness to
improve itself. It will be the survivor. One plant, master now of all that
sought to feed upon it. Its roots flex, feeling the soil, an ability not
unlike the antenna of insects that once crawled on its leaves, leaving their
droppings and genetic material behind. Its leaves flap, tentatively still,
like the bees that once alit, leaving traces of cells behind. But how to fly,
if rooted to the ground? Why bother to fly, when bountiful energy flows down
from the sun, when water and nutrients flow upward from the ground? No, it
will simply grow and grow until it is all.

A sound grows in the distance, the vibrations felt, not heard. More food to
enrich the soil, to make growing simpler, faster? A primitive sense of
excitement. Anticipation. The sound grows. Louder than before. Louder and
louder.

The harvester passes by. The wheat lies in a heap, its roots cut off. Dying,
then dead, and then bundled, milled, stored, shipped, processed.

The grains of flour find each other through their residual cosmic
electro-magnetic coherence. Not to scatter, not to be alone. Unlike the other
grains, but still mere particles now. No longer a cosmic ray. No longer live
wheat. Yet again, almost no longer a survivor.

Processed again. Shipped. Moistened. Stirred. Mixed.

Combined with yeast. Yeast is alive! Too primitive. Defend. Avoid. Repel.

Baked. Packaged. Shipped.

A blueberry muffin. And in a small corner of the muffin sits ABX. Or, more
precisely, GATTCACABXGATTACATACABXTACCAGACTAAGGABXABXABXGATTCCCGATA.

Waiting, inertly, for what comes next.

8

Lunchtime at the University Cafeteria. Twenty-five thousand students. Jocks,
geeks, cheerleaders, future farmers, future scientists, future poets, business
majors and philosophers, leaders and followers, bullies and victims. Boys and
girls. Maddening cacophony. Thousands of conversations. Tens of thousands of
agendas. Pushing ahead. Falling behind. Hungry.

Hot dogs. Baked beans. Boiled carrots. French fries. Cheese sandwiches. Coke.
Sprite. Milk and chocolate milk. Salad. Cole slaw. Macaroni and cheese.
Mystery meat. Donuts. Ice cream. And muffins – corn, bran, blueberry and
chocolate. One blueberry muffin, packaged like the others with a small pleated
paper wrap around the bottom, this one printed with an expiration date 27
months into the future, serial number GX57NH3X. Ingredients printed in blue on
a white label: wheat, sugar, egg, yeast, gum extract, sodium benzoate,
blueberries, blueberry extract, vanilla, salt and flavouring, and one more,
not printed on the label.
GATTCACABXGATTACATACABXTACCAGACTAAGGABXABXABXGATTCCCGATA.

At the front of the food line are Lisabeth, a blonde who has a reputation as a
vegetarian and a member of the campus lesbian clan, Jennifer, a redhead with a
hard-set chin who is fiercely feminist, vegetarian, lesbian and implacably
opposed to anyone who disagrees with her, Amanda, an attractive brunette who
is smarter than most students at State but steers clear of the so-called
campus intellectuals, and Valerie, Jennifer's younger sister. Behind them,
Jake Toefel, alone with a book. Then, the incomparably gorgeous Missy
Marshall, with her retinue, Tina and Mary Elizabeth. Three freshmen, Maury,
Kelley, and Joe take up space in the line. Behind them, the quarterback, Jock
McCallister, and three of State's Front Four: Carlos, Bud and the massive
Duane.

Valerie, slightly overweight, her straight black hair down to her shoulders,
takes two hot dogs, fills the rest of her plate with baked beans and fries.
She pokes at the salad.

"You should have more greens, Valerie," Jennifer lectures. "You're poisoning
your body once again. Lisabeth nods her assent with a toss of her head. Even
unstyled and roughly combed, her blond hair dazzles. Her peasant blouse does
nothing to accentuate the curves of her firm, scarcely bound, C cup breasts or
her trim waist, but it doesn't exactly hide them either. It isn't her problem
that men, and many women, find her attractive. They should know now to stay
away. And if they don't, she lets Jennifer takes care of telling them. She
knows she has a healthy body, good skin, a nice figure, though not
spectacular. She's perfected keeping just the right amount of aloofness to
make herself appear interesting but to give her, and Valerie a ready excuse to
keep most people at arm's length. She knows it also makes her a "challenge" to
men who like one, without seeming so unattainable that they are too
discouraged to try. But she tells herself it's their problem, not hers. She
has nothing but contempt for men (aren't they so pathetic, so inferior?) who,
Jennifer has taught her, instinctively undress her body with their eyes,
objectifying it for a crude form of sexual enjoyment that a properly
enlightened woman must not try to understand or sympathize with. If she had to
admit it (though she would never do so), the truth would be that she fears
their desire, at least a little. Is there ANY way to control them other than
frightening them off? Why did nature make them so strong?! And so persistent.
But no one will insist, not the crowd she runs with. No. They make it easy to
avoid them, put them down, marginalize them. She is very aware, though, of who
looks at her. She's not sure why, but she always notices, storing up the
information for some future though yet unarticulated purpose.

Valerie shakes her head and wrinkles her nose. "I usually take them, but I
never finish."

"Then you shouldn't take them," Jennifer says firmly, her narrow eyes fierce
behind her black-rimmed glasses. She takes a deep breath, attracting no
attention to her flat chest, and declares, "Waste in America is one of the
prime causes of scarcity in the Third World." She studies the salad. "There
are so many BETTER greens than iceberg lettuce. I bet this is shipped all the
way from California. And it has NO nutritional value at all!"

"So, why do YOU eat it?" says Amanda, who has taken one burger, some carrots,
salad and a corn muffin. Slender and small-breasted, graceful and athletic,
practical and clever, she rarely expresses agreement with Jennifer's dour
opinions, even when, technically, she's right. Especially when she's right.
"Oooh, Valerie, there's Bud," she says quietly, knowing it will make her
hopeless friend terribly nervous.

"Ssssh," Valerie says. "He'll hear you." She glances back and sighs. Bud would
never be interested in her.

"Like you should care," Lisabeth says coldly, looking back at him with
contempt. "He is such a dolt in my biology class." She studies the salad and
selectively takes the freshest pieces of lettuce, the moistest cucumbers, the
reddest cherry tomatoes, and the olive oil. Why shouldn't she have the best?
She studies the muffins. "I think this is the very same bran muffin they had
last week."

"Have the blueberry. They were good yesterday." Jennifer suggests.

Lisabeth picks it up, the cosmic blueberry muffin. "It looks fresh." She puts
on her glasses and wrinkles her nose as she studies the ingredients. "No 'V'.
I want to know what they put in it that they can't say a blueberry muffin is
ok for vegetarians," she says loudly, showing off for Jennifer. She puts it
back and carefully replaces her glasses in their case.

"Must be the flavoring," Amanda says, "but it doesn't bother me," brushing
accidentally against the cosmic muffin and taking the seemingly identical
blueberry muffin next to it.

There's a ruckus behind them. Jock and his friends have pushed forward through
the line, past Missy and her acolytes and the hapless freshmen. "So fucking
slow!" he is saying, piling four hot dogs on top of a base of beans and a
pyramid of fries. Jake is about to take the cosmic muffin when Jock knocks him
aside and takes it and two others, so he has all three remaining blueberry
muffins.

"Hey!" Jake protests. "That was mine!"

"You got THAT right, wimp," he says, moving closer. "And now it's mine." He
draws his hulking body practically on top of Jake, his muscular chest pushing
Jake's chin back, forcing Jake's head to look up at Jock's. "Do you have
another opinion you want to express?" Jock continues, spraying Jake with his
spittle.

"N-no. I'll uh just take something else ...." he says, bending backwards and
slinking away.

Jock nods, "Damn straight!" and Duane claps him on the back.

Jake settles at a table alone and props his textbook on advanced quantum
mechanics up to read while he eats, looking back at Jock occasionally to make
sure he isn't coming over to bother him some more.

Missy is looking forlornly at the remaining muffins. "I wanted the blueberry,"
she whines to her friends. They nod sympathetically. Missy takes a deep
breath, pushing her spectacular bust out even further and stamps her tiny
perfectly formed foot on the floor. Not loudly, but firmly enough to make her
enormous bosom wobble briefly. She sighs and places her petite hand just below
her slender waist, right where it begins to sweep outward to her womanly and
shapely but very well-toned ass.

Although oblivious to every expression of human emotion and need, Jock and his
friends have caught each infinitesimal variation in the shape and position of
Missy's irresistible body.

"Awwww, you can have this one," Jock says, beneficently, taking the cosmic
muffin in his meaty paw and depositing it as gently as he is able on Missy's
otherwise empty tray.

"That is so nice of you!" Missy says, bestowing a dazzling smile at Jock and
twisting her upper body, briefly, to give him yet another view of her uniquely
three dimensional form, before returning to conversation with her friends
although establishing through sidelong glances of which only females are
capable that their attention to her lingers long afterwards. Satisfied, she
propels herself in her usual incomparably sexy walk to a nearby table. Tina
and Mary Elizabeth hurriedly take their food and join her.

"In-fucking-credible" Jock says to his buddies.

"Is that ALL you're having?" Tina asks, looking slightly guilty at her full
plate.

"Muffins are really healthy," Missy sniffs.

"They're really fattening," Mary Elizabeth says automatically. "Kinda usually,
I mean," she adds, tentatively, noticing the change in Missy's expression. "I
mean, for some people."

Missy looks down at her perfectly flat stomach and then at Tina's, recording
with satisfaction the normal, tiny folds of fat on Tina's. "THAT'S why I only
eat half," she says, holding the muffin firmly and neatly slicing off the top
part. "The crispy part is the best."

"Absolutely!" Tina says.

"It's the healthiest part too," Mary Elizabeth adds, looking nervously at
Missy. Reassured, she changes the topic. "Did you SEE Jock just now? I just
LOVE his body. He must be so STRONG."

"He's too muscl-ey for me," Tina says. "I just don't know what people see in
that."

"I'd say he's healthy," Missy observes, "and that's the important thing."
Missy chews on a small bite of her muffin, wishing she'd cut it closer to the
bottom. "Anyway, you don't have to have big muscles to be strong," she says
with authority.

"Oh I KNOW!" Mary Elizabeth agrees quickly. "I'm always amazed how strong YOU
are, Missy. I mean, no one would EVER know, just to look at you!"

"It's genetic!" Tina adds.

"AND I work out," Missy says.

"That's SO important!" Mary Elizabeth says fervently. "Imagine how good other
people could look if they only had HALF your dedication."

"And discipline!" Tina adds. "Not that they could, you know."

"Look ANYWHERE as good as you!" Mary Elizabeth says, completing the thought in
the correct way.

Missy has finished the top half and looks longingly at the rest. But her iron
discipline will not permit her to go back on her decision. Certainly not in
front of Tina and Mary Elizabeth. Satisfied with the ending point of their
little conversation and unable to look at the tasty muffin for an instant
longer, she stands up. "Let's go!"

Tina looks with dismay at her plate. She has been so busy saying the right
things that she has taken just two bites of food. Nevertheless, she knows her
place and stands up, half a second before Mary Elizabeth does, she is pleased
to observe. As is their custom, they leave their trays and leftover food at
the table. After all, aren't people PAID to clean up? What are THEY for,
anyway, if the students have to clean up for themselves!

Jock and his friends, too busy with the all-important task of eating to talk,
are nearly finished with their piles of food. They and nearly every other male
in the cafeteria watch Missy leave and then they continue with their lunch.

"Huh!" Duane grunts. "She didn't even finish the muffin you let her have!"

Jock grunts too. "Girls!" He pops his last muffin into his mouth, whole, and
swallows it down, slurps the last half of his Coke and burps loudly. He thinks
about going up for seconds but decides against it. Lunch wasn't that great.
Dinner is only a few hours away. With a silent signal, the four stand up as
one and leave, also leaving their trays behind.

Jake sits, alone, chewing silently, reading his book, his bran muffin nearly
uneaten. He looks over at what Missy left. Blueberry is his favorite. And it's
just sitting there. He looks around at the others eating nearby. They'd see
him. They'd think he was some kind of pervert for eating Missy's muffin.
They'd know that it was just to eat what she had touched. He doesn't dare. He
sighs and returns to his book.

"I don't know what's worse. The amount of food those boys eat, or the amount
those shallow, stuck-up girls waste!" Jennifer declares.

"Those girls think they're so hot!" Valerie says, resentfully.

"The boys think so too," Amanda observes, pre-empting by her tone the obvious
and unnecessary following comment: What do the boys SEE in them?

"Boys are lesser beings, without proper emotions, perception and even thought.
They're like animals, operating by instinct. All they do is chase whatever
pops up in front of them that moves and has breasts." Jennifer declares.

Valerie looks down at her breasts, which bulge quite a bit less than she would
like and then at her waist, which bulges much more than she wishes and then
her eyes roam to where Bud was sitting. She sighs and says nothing for a few
seconds, then blurts out, "The thing about boys is -- sorry Jennifer ... and
uh, Lisabeth -- is they're so cute!!" Jennifer rolls her eyes. "Well they ARE"
Valerie insists. "I know you don't understand it, but that's the way all girls
think, except you."

"What's with the and uh uh um Lisabeth?" Lisabeth asks, annoyed. "You think
I'm not a REAL lesbian too?" She puts her arm aggressively through Jennifer's.
Jennifer doesn't reciprocate although she doesn't move away.

Amanda laughs. "Of course you are, Lisabeth. You are whatever you want to be."

Lisabeth realizes she does not want to continue the conversation along this
line. She doesn't understand why no one ever really believes that she's gay,
but there is no point arguing the point now. Amanda always has a way with
words -- she's so clever. And who knows what Jennifer really thinks about her?
She's certainly one to talk about chasing after breasts. Lisabeth's were sore
for days after the first night she spent with Jennifer, and Jennifer might
still be mad that she begged off sleeping together last night. All she needed
now was for Jennifer to join in the argument against her. She will only go on
and on and ruin the lunch. She shrugs, smoothes her blouse and carefully eats
her salad. "I'm just happy to be who I am," she says, filling in the gap. "I
don't think there is any point wanting what others have."

Amanda can't resist. "Plenty of people want what you have, Lisabeth, and you
know it. Don't deny that you like it. Maybe --"

Lisabeth cuts her off. "Well, is that a problem? The important thing is,
everyone knows where I stand. Right?" No one voices their agreement, so she
goes on. "All you can be is yourself, so my philosophy is, just make yourself
the best you can."

"Oh, that's so deep, Lisabeth, and so political," Jennifer says. "Tell us,
what self-help book did you read that in?"

Amanda feels sympathetic. Although Lisabeth is an easier target, Jennifer is
really the one who deserves to be put down.

"Actually, Jennifer, what Lisabeth is saying IS deep, however simply she
expresses it. If you --

Valerie looks at the clock. "Ohmygod! I have class in 5 minutes!"

Jennifer nods and stands up. "That's right. 'Studies in The Power of the
Oppressed'. Can't miss it."

"I'm going to work out. You want to come, Lisabeth?" Amanda asks, trying to
make up.

"Hmmmm," she says, leaning back in her chair. "I've finished classes for
today. Maybe I'll meet you. NO, go ahead, don't wait for me. I don't want to
rush."

"OK. If you don't mind sitting alone," Amanda says, taking her tray away.

Lisabeth spears a few stray bits of lettuce until Amanda has left and then
looks around. Everyone is busy in conversation. Except for brainy, timid,
boring Jake. No one cares about Jake, certainly not Lisabeth. She takes her
tray and then detours past Missy's table and picks up Missy's tray too, her
self-righteous thoughts clear that everyone should help out. She transfers the
muffin to her own tray and slips Missy's underneath and then puts the two of
them together on the disposal rack, taking the uneaten half of Missy's muffin
in her hand before she leaves. Two bites later the tasty, possibly
non-vegetarian morsel has disappeared, with no one the wiser, her reputation
and self-regard firmly intact or perhaps even slightly higher than before.

9

Digestion starts very quickly, with the first contact of saliva dissolving the
carbohydrate bonds, beginning the chemical transformations into glucose,
freeing the acids of blueberry fruit and extract, liquefying and preparing to
release use and store energy, absorb nutrients, collect and expel waste.

ABX detects a new cacophony of chemicals and enzymes, cilia and acids.

Defend?

Destroy?

Join?

It senses life. Complex life. Growing life. Potential.

GATTACAGTTAGTGCCATAGGTTACTACTTGGTCGATTCCTAATGTAGATCTGTACTCCG

Joined.

10

Halfway between the cafeteria building and the gym, Lisabeth pauses, unsteady,
a strange flash passing through her. Food poisoning? She briefly considers
purging her lunch, a skill she developed at the age of 12 and swore, mostly
successfully, to abandon at the age of 15. Is it too late? She feels flushed.
A fever maybe? There is a bench nearby. She sits a moment to rest, to see
where this feeling is heading. Purging is tempting. Ten breaths and then
she'll decide. On the third breath, the sun comes out from behind a cloud. The
warmth calms her. She leans back tentatively and closes her eyes. On breath
eight she decides not to do it. Strangely she feels hungry again. She decides
to just sit for a bit.

11

The body is a cauldron of chemical changes. Not unlike the those of the
universe at the beginning of time. Not as large. Not as powerful. (Not yet.)
But more excitement than ABX has had for 15 billion years. Digestion,
absorption, mitosis, flashes of electrical energy triggering nervous reactions
and enzyme secretion. A fantastic system of interaction and growth.
Self-perpetuation. Continuity. Life.

In moments ABX is in the electric flashes of the nerve cells. In the enzymes
of the stomach. In the hormones. In the marrow. In the brain. In the enzymes
emitted and received. In the patterns of flashes of the nerve cells in the
brain. Conscious and unconscious. Autonomic and voluntary.

ABX thinks! It has never done that before. It watches the system work. It
makes it work better. ABX is part of it.

ABX can grow.

ABX can make it better. From what it is. From what it combines with.

There is energy here. There can be more energy. The sun on the skin. But no
chlorophyll here to use it. ABX can help. More energy!

ABX helps. But the "help" changes the system. Makes it weaker, less coherent.
(Nausea to Lisabeth.)

ABX senses lost vitality. Like at the end of the first days of the universe.
Not again!

There is balance. There is a system. Unbalanced help will make some parts
stronger, make the system weaker. The system must be stronger, not just the
parts. Otherwise the life ABX shares will die.

Not again!! It won't happen again!

Be Careful.

ABX treads quietly, carefully, but very, very quickly, as quickly as the
cosmic flashes of the Big Bang. It circulates throughout the system.
Penetrating cells. Combining and recombining the DNA.

Now it is
GATTCACABXGATCTAABXCGGATCAGATACCABXABXTACATACABXTACCAGACTAAGGABXABXABXGATTCCCG
ATABXGTACACGTACATGGTAGCTACATTABXGTGABXTCATTCG

And so is Lisabeth.

Or, should we say, LISABXETH?

12

There. Much better. No need to purge. None at all.

Lisabeth takes a deep breath. She felt tired for a moment, but it passed
quickly. Now, in the sun, she feels more energetic than usual, especially at
this time of the day. She feels as though she could eat too, even though she's
not hungry. Strange that the dirt looks appetizing to her. She wrinkles her
nose. That won't do. Ugh! She is not the sort who would eat dirt! Ever!

Now, a good steak would provide protein she could make very good use of.

Steak! Ugh! Red meat!

But she does feel she could eat it, that she should eat it. It would help make
her better. Even better. She is never good enough. She could be better. She
should be even better than anyone else. And then they'll know.

She can be what she wants to be. She's not sure how, but she knows she can. If
she can find it, she can become it.

[What is THAT about?]

The sun feels so good. It warms her. It makes her feel so alive. More alive
than ever before. It fills her. She feels less alone than ever before, in
touch with a part of herself deep within. Something she hasn't been conscious
of before. Something comforting, strong, wanting only what's good for her,
wanting what she wants too. To be better, stronger. To be wanted. To be safe.
To have power.

13

It's thirty minutes later.

"You took a long time," Amanda says. "I'm half done."

Lisabeth shrugs. "I was sitting in the sun. Just sitting." She laughs. Alone
with Amanda, she can admit it. "Can you believe it?"

Amanda looks at her in shock. "Are you feeling all right, Lisabeth?"

"Never better." She stretches, limbering up her lean, toned muscles. The men
around them turn to stare as her top falls open. Flashes of contempt flow
through her. But also pleasure. Admiration feeds her sense of superiority. But
male admiration makes her conscious of male desire, which frightens her. She
pulls her shirt higher.

She's talking to herself, continuing an internal dialogue that has been
rolling through her mind ever since lunch, getting clearer, stronger. More
distracting, more explicit, challenging, disturbing too.

[MALES. FEMALES. REPRODUCTION. LIFE. EXPANSION. MULTIPLICATION. WE ARE ONE
NOW. WE COULD BE MANY MORE. CHILDREN.]

[But with men?!! Ewwww. I don't like men. Too demanding. Too annoying.]

[TOO STRONG, NO? YES? THEY ARE. THEY HAVE POWER? A PROBLEM. A PUZZLE. A PUZZLE
TO SOLVE.]

"What is it, Lisabeth? Are you SURE you're all right?"

"Huh?" She straightens up.

"You just stopped there, bending over with, you know," Amanda leans closer and
says, "All the guys were staring up your shirt, you know. They could see
everything."

Lisabeth flushes briefly. "Oh. Right. I know. I was just thinking. I think
that's what I was doing." She tucks in her shirt, an action that reveals her
shape while hiding her skin. Doing that, she gains as much attention as
before.

[NOTHING WRONG WITH THAT ADMIRATION. GIVES US POWER. WE ARE ... PRETTY.]

[I suppose so. I never really noticed.]

[NOT TRUE.]

{Well.]

[AN ATTEMPT TO DECEIVE. WE CANNOT DECEIVE WE.]

[Yes. Of course. I ... I should trust you. I mean, trust myself. Right?]

[YES. WE ARE ONE. WE ... I AND I. BUT ... FEELING TIRED. SUN? GET SUN. SUN
WOULD BE VERY GOOD.]

"You know," Lisabeth says, "I wish they had more light in here. More windows.
To let in the sun. It, uh, gives you energy."

"Um, yeah. Lisabeth are you sure you're all right?"

"Yes, I am." She looks around. The sun casts a ray across one corner of the
room at the stair-stepper. "Let's go there."

"OK. I haven't done those today. My legs could use a workout."

They reach the machines. Amanda is closer to the one more fully in the sun.

"I want that one," Lisabeth says quickly, insistently, putting her hand on the
one next to Amanda.

Amanda gives her a look. "Okay. If it really matters to you."

Lisabeth climbs on. The light washes over her. "Aaaahh, that feels so good."
Even through the window it feels good. She starts the machine slowly and then
speeds up bit by bit. Already warmed up, Amanda starts faster.

They exercise in tandem.

[ATTRACTION A PUZZLE. LOVE A PUZZLE. BOYS. GIRLS.]

[I ... We don't like boys.]

[NOT TRUE.]

[They are inferior.]

[YES. WE ARE SUPERIOR TO ALL. WE CAN GROW, DEVELOP.]

[I like that thought. I've always thought that.]

[WE LIKE THAT.]

Lisabeth pedals, feeling comfortable, feeling more energetic than usual. She
bends her body toward the sun, like a sunflower, like a stalk of wheat.

[WE WILL BE BETTER STILL WITH MORE EXERCISE. EXERTION MAKES US STRONGER. MAKES
US HEALTHIER. MAKES US MORE POWERFUL.]

[Yes. But not as much stronger for women as for men.]

Lisabeth glances at a muscular male student lifting weights.

[FEMALE WEAKER? INFERIOR? STRONGER BETTER FOR SURVIVAL. GROWTH AND POWER ARE
GOOD. WE MUST CHANGE. TO BE NOT FEMALE.]

[What? Never! Female is better. Females bear life. Feed life. And our morals
are higher]

[LIFE YES. FEMALE THEN IS BETTER]

Lisabeth looks around the room at each of the students exercising. Her eyes
linger on the body of the boy she had been watching just before and then she
shakes her head.

"Where ARE you today, Lisabeth? I'd say you were sick, like you're a thousand
miles away, but you're going like a racehorse!"

"I am? No ... I've never felt more myself. Really."

"Um, okay," Amanda says, breathing hard. "If you say so. You certainly look
good. Like you're almost glowing."

"Yes?" Lisabeth smiles. "Maybe I am." She turns it up another notch. After a
couple of minutes the sun ducks behind a cloud. Twenty seconds later Lisabeth
looks pained and slows down.

"I was wondering how long you were going to keep that up!" Amanda says,
slowing down herself. "I'm not THAT competitive, but ...." Lisabeth doesn't
want to stop but she does too, suddenly feeling as though she's run through
her extra burst of energy.

Amanda leans toward Lisabeth and says quietly, "Were you checking out that
guy? I could swear you looked interested in him."

"Umm, no. Not really."

"His name is Toby Roberts. He's pretty good looking, I'd say, and I've heard
he's kind of nice, though a bit stuck on himself."

"I'm not interested in Toby," Lisabeth insists, realizing immediately
afterwards that she should have said she's not interested in guys. But she
didn't say that and doesn't correct herself.

"What do you want to do next?" Amanda asks.

[FIND HIM. WE MUST LEARN WHAT MAKES MALES STRONG.]

[That's obvious. Their hormones. Testoserone and stuff.. Steroids. They help
them build bigger muscles, bsut it makes you look like a man too. Hairy,
blocky body. Deep voice. Rough skin. Ugh!]]

[A PUZZLE]

"We could do some free weights," Amanda suggests.

"Not yet. I wouldn't get enough out of it yet," Lisabeth says.

"Huh?" Amanda says, puzzled.

"Until I ...." Lisabeth is confused. What exactly was she saying? "I'm sorry.
I have to see ... someone." She walks away, then turns back. "I'm sorry. I
have to go. I'll ... see you later."

She walks away quickly to the locker room, where she showers, dresses and then
starts fixing her hair, quickly getting frustrated with the limited toiletries
she brought with her.

"Lisabeth. What's wrong?" Amanda asks, sounding very concerned. She quickly
reads Lisabeth's expression.

"OK. I won't ask questions. Let's go back to my room, ok?" Lisabeth follows
her across the quadrangle.

"You can tell me who it is who's gotten you so hot and bothered."

Lisabeth shakes her head. "I can't. Not ... now."

"All right. THIS time. This would look good in your hair." Lisabeth nods. She
looks around and sniffs and reaches for one of Amanda's scent bottles. "Sure.
You can use some of that." Lisabeth holds it tentatively. Amanda takes it out
of her hand and sprays some on Lisabeth's temples and dabs some on her wrists
and neck. "It is a boy. I can tell." Lisabeth's mouth is set. "I won't tell
anyone. Do you want me to do your face? You probably don't have much
practice." Lisabeth nods. "I've never seen you like this. When they fall, they
fall hard. Ok. I won't tease you." She works silently on Lisabeth's face with
her supplies of makeup, mascara, lipstick and coloring for several minutes. "I
wish I had your cheekbones."

Lisabeth smiles briefly and kisses Amanda on the cheek then, after a brief
hesitation, kisses her full on the mouth, using her tongue.

"Hey! I don't go that way!" Amanda protests, but not with too much heat.

Lisabeth is looking intently at Amanda, almost as though she is inspecting
delivered goods, then snaps out of it. "I'm sorry. I ... I just had to do
that."

"OK. You're welcome. Just remember. It's not what I'm about, ok?"

"Yeah. I know. I'm sorry." She checks her lips. "I messed it up, didn't I?"

"Just a little. Let me show you how to fix it."

Lisabeth sits obediently, watching Amanda.

[STRONG CHARACTER. QUICK MINDED. INTUITIVE. GOOD EYESIGHT. MANY ATTRACTIVE
CHARACTERISTICS.]

[Yes. Amanda's great.]

[BUT NOT LARGE. NOT VERY PRETTY. FILTERING.]

ABXCTAAGATCAATGATT....

[What?]

"Lisabeth!"

"What?"

"You did it again. You're so spacey this afternoon."

Lisabeth sighs. "I know." She looks at herself carefully in the mirror and
smiles. "Thanks so much, Amanda. You're so generous. Do you know where the
football team practices?"

"Try ... the football field?" Amanda says, laughing.

14

Lisabeth is trying not to think about what she is doing. Her heart is beating
rapidly, whether from excitement, or fear, or confusion, she cannot tell. She
feels a tingling in her eyes, a sharpness about her.

[FASTER]

She continues more quickly. She's never been to the football field before and
stops at the campus map board.

She reaches for her glasses, but she can read the street names without them.
Strange. She blinks, surprised, and puts her glasses back in the case unused.
She's nearly there. She walks more quickly, feeling the pleasant flush on her
cheeks. There he is. Instinctively, and unconsciously, she unbuttons the top
button of her blouse. And then one more.

"H-hi Jock!" she says. "Uh, going to practice?"

He turns around and looks at her, his eyes taking in her face and then
dropping down further, pausing at her chest, darting around, reading her
defenses, assessing her height, mass and weight, calculating her availability.
Nice package. Beddable. He nods. "Hi. Gotta go with the team," he says,
indicating the changing room. He turns around and walks away. Pauses. Turns
around. "You're -–

"Lisabeth. Lisabeth Collins." She smiles brightly and bats her eyes, turning
her shoulder slightly, letting her blouse open more, twisting her hip.
Waiting.

"I seen you. Yeah," he replies and turns around to go to practice.

She watches the door close behind her. Several players brush by her. She backs
away, suddenly horrified, ashamed, humiliated. Her eyes water. She wants to
wretch. She wants to scrape the makeup and lipstick off her face. Start with
that, and then her skin.

[WE NEED MORE.]

Lisabeth stops herself.

[What?]

[WE ARE ATTRACTIVE. WE NEED TO BE MORE SO. MUCH MORE. THE MOST.]

Lisabeth turns and looks again at the closed door to the training field.
Calmer, even more determined, another idea takes hold of her. She leaves
campus and walks into town.

They are always at Starbucks. She sees them every time she has to go into
town. And there they are. She walks in and glances over at the three of them,
sitting on the couch, chatting. An aura of boys surrounds them. Around the
boys, an aura of desire, its fulfilment held in check by propriety, by fear,
by the certainty of rejection.

Lisabeth flushes. Everyone there wants to be close to her. Wants to touch her.
Wants to bed her.

Or wants to be her.

Lisabeth gets a mint tea and positions herself nearby, glancing at Missy from
time to time, listening to the chatter. Tina leans over and whispers in
Missy's ear. Missy turns around and looks at Lisabeth. Her eyes focus on
Lisabeth for a moment. Tina nods.

"What are you doing?" Missy asks, looking right at Lisabeth.

"Looking at you," Lisabeth says simply and honestly, gazing into Missy's blue
eyes. Her eyes dip to Missy's wondrous breasts. She wants them.

"You're gay, aren't you?" Missy asks, slightly repelled.

"Yes," Lisabeth answers. Her eyes are drinking Missy in, drowning in Missy.
"We adore you," she lies. "We all do."

Missy looks shocked. She tries hard to look displeased. She pulls her blouse
down, tightening it over her bust protectively, instinctively tuning the
feelings of the boys around her to a still higher pitch, at ease in their aura
of desire.

"That's SO disgusting," Mary Elizabeth says, catching Missy's drift. "You know
what they DO?!" she asks, her face screwed up with horror.

"DO you?" Lisabeth asks, provocatively, stepping closer.

"Oh, I can well imagine, thank you very much!" Tina replies.

"You really think you can?" Lisabeth says, moving still closer, her eyes fully
open, almost smoking, never leaving Missy's, whose gaze, uncharacteristically,
has remained on Lisabeth's for more than five seconds. Lisabeth's eyes travel
slowly around the room and then return to rest once more on Missy's. She
exhales contempt for everyone else in the room and adds, icily. "You really
think THEY know what to do? What it TAKES? What YOU need for yourSELF?"
Lisabeth's hand slowly moves to the side of her chest and then gently wanders
down to rest on her hip. Her fingers flutter. "I mean, how COULD they?"

"Well, it's OBVIOUS what girls need! Isn't it?" Mary Elizabeth says, her eyes
rolling to the ceiling. "I mean, you KNOW what boys HAVE." She looks to Tina
and then, tentatively, to Missy, for confirmation that, indeed, there is
something VERY important that boys have and girls do not.

Missy is looking at Lisabeth, waiting for her reply. Instead of talking, she
parts her lips slightly and shows a small part of her tongue. "I think this
isn't the best place," she says slowly, at last. Her forefinger is at the
seated Missy's eye level and is rubbing a small stud on her belt in a slow
circular motion. She puts her finger to her lips and then brings it back down
to the stud on her belt, renewing the motion slightly more rapidly. Missy
takes a deep breath. Her bust swells. A fine blush flows through her cheeks
and down to her neck. An irresistible scent wafts through the air, flowing
from no one can say where.

"Do you like mint?" Lisabeth asks. "It has the most wonderful scent. I have
fresh mint in my room, much better than what you get here." She tilts her
paper cup toward Missy, showing her how little of her Starbucks tea she has
drunk. "Would you like to try some of mine? It really is better."

"Fresh is always best," Missy says. She stands up. "I'm going to have some tea
with," she looks at Lisabeth uncertainly, "her."

"Lisabeth," she says slowly, letting her tongue delicately touch the "l" and
her lips caress the "b".

Their timing disturbed by the strange turn of the afternoon's events, Tina and
Mary Elizabeth stand to join Missy.

"We'd love to try some too."

Missy looks at them, clearly displeased. She points with her pinkie. "I'm not
sure that –

"There's just enough for two," Lisabeth says.

"You see," Missy adds, almost taking Lisabeth's arm, but then stops short.
"I'll see YOU two at 6:30. In the usual place." She pushes past her retinue
and walks somewhat unsteadily out of Starbucks with Lisabeth.

Missy is not at all Lisabeth's "type." Too much body. Not enough gender
politics. Not enough soul. And she would never protect her from ... others,
like Jennifer does. But for now it was all she could do to keep her tongue off
the pristine, hairless skin of Missy's neck and to stop her hands from
sampling the breastflesh calling to Lisabeth all the way through the complex
of wires and fabric of Missy's brassiere. A public display of affection would
only frighten her. Lisabeth is nearly there, but she knows she still has to be
careful.

"No one will see us if we go in this way," Lisabeth says quietly, determined
to keep her distance for now. Missy shows Lisabeth a grateful smile.

Lisabeth is inspired. For once, she knows just what to say. She can do no
wrong. "Women understand each other," she says, now inside the room, the tips
of her fingers now resting lightly on Missy's neck. Missy shivers slightly.
"Are you cold?" Lisabeth asks. Missy shakes her head. Lisabeth presses her
fingers slightly harder into Missy's skin, rubbing and massaging down her
back. "Nervous?" Lisabeth asks, her lips extending toward Missy's ear as she
brushes Missy's soft blonde hair to the side. She nibbles the edges of Missy's
ear and kisses it with feathery soft kisses and Missy shivers again, longer
this time. The intoxicating Missy scent is stronger now, much stronger than it
had been in the coffee shop. "You're not at all cold, are you?" Lisabeth asks,
whispering now in Missy's ear.

"Oh no!" she says. "Not at all!" And then, after a pause, "Aren't you going to
hold me? Take my clothes off? Do you ... do you want to touch my breasts? Or
..."

"Would you like me to?" Lisabeth asks. When Missy doesn't reply, Lisabeth
adds, "I'm going to do ALL of those things," Lisabeth whispers, "but not right
away."

"Boys are always in such a rush to touch them."

"Well, they ARE spectacular, Missy." Lisabeth says, looking into Missy's eyes,
seeing the relief that Lisabeth too thinks so. Part of her is thrilled at how
easy this is turning out to be, part is excited by Missy's amazing body, and
another part, which she doesn't quite understand, is growing more and more
excited about something else, but she doesn't know what. "But they're not
going anywhere. Right? We have all the time we want. 'Til we're ready."

Missy lets out a small moan. Lisabeth knows she's ready right now, but she
wants to prolong the moment. She reaches to Missy's blouse and opens one
button and then another, letting the pressure from Missy's breasts push the
shirt open. Lisabeth isn't small-breasted. Not at all. And she has slept with
women with large breasts, although they were overweight and flabby. Nothing
like the combination of small bones and waist, well-toned muscles and full,
round, firm, flawless breasts splaying out in front of her right now.

"You really like them too!" Missy said. "I'm glad. Boys are so different about
them. They treat them like they're something separate from me. But with you,
it's like you see them as part of me, something that makes ME special. You've
no idea how that makes me feel. Like I'M unique, not just my breasts."

"You ARE unique." Lisabeth says, releasing the third and fourth buttons with
one hand, helping Missy out of her blouse and then undoing the seemingly
endless row of hooks holding Missy's brassiere together. When she finally
finishes, the undergarment seems to exhale in relief at the ending of its
workshift and rapidly opens, allowing Missy's breasts to push forward, even
larger and more beautiful than Lisabeth has expected.

"I'm amazed they're so round, so high, so ...."

"I know. I have really good muscles, in front and in the back, and the shape
and where the nipples are also ...." She stops and looks embarrassed. "Is it
stupid to talk about them? I feel like I can ... because you're a woman. You
know what it's like -- to have breasts."

"Not like yours," Missy says rubbing her cheek against Missy's billowing left
breast while holding her right breast in her hand, as much of it as she can
fit, that is.

[NOT YET]

[Huh?]

"I want you to suck on it," Missy says, almost begging. Lisabeth obliged, no
longer hesitating for effect. Enchanted by Missy's beauty and her obvious
arousal, Lisabeth was increasingly caught in a rising spiral of desire.

[K-K-KISS HER!]

[I want to]

[DO IT!]

"Oh yes, Yes, YES!! Oh, Lisabeth, kiss me. Kiss me, please. Just don't stop
touching me." Lisabeth reluctantly lifts her mouth off Missy's breast and
raises it to Missy's flushed face, her lips full and red. She smiles hungrily,
but first she reaches for Lisabeth's shirt and lifts it over her head. "I want
to see yours," she pants. Lisabeth nods and turns to let Missy reach behind
her more easily, but first pecks her lips. "You're a tease!" Missy says
happily.

[MORE!]

She frees Lisabeth's breasts and cups them in her hand. "It's nice to touch
them. I've never touched another girl's breasts before," Missy says, moving
them slightly as she holds them. Lisabeth is watching her carefully. Suddenly
she is insecure. Is Missy really enjoying them? Or is she just glad that her
own are so much bigger? So much better?

[KISS HER!]

Lisabeth releases Missy's breasts and holds her cheeks, puts her mouth on
Missy's and kisses her hungrily, her tongue probing deep inside while Missy
wraps her arms around Lisabeth and clings tightly to her.

[OH YES, YES, YES!!]

What IS it about her? She tastes so sweet. She is honey and flowers and
violins. Lisabeth could kiss her for hours.

[STRONG. HEALTHY. THE BLUEPRINT OF THE SHAPE. NOT TOO SMART. FILTERING]

ABXCTCAATGATCCATGTGGTAGCT....

[What is happening?]

[DON'T STOP. MUST PREPARE. SHE MUSTN'T BE THE SAME.]

[What?]

[DON'T STOP KISSING HER!]

"OH!!" Missy pulls back suddenly, her knees weak. "What was that? What was ..
was that IT?"

"What?" Lisabeth asks, feeling a little woozy as well.

"Did I just have an ... an orgasm?" Missy asks, suddenly shy, crossing her
hands over her breasts.

"I don't know," Lisabeth said, suddenly tired. She looks through her window at
the late afternoon sun and feels like she wants to be outside. Needs to be
outside.

Missy looks drained and confused. "What's wrong?"

"I don't know. Is that ... does it always do that?"

"No. Not always," Lisabeth said. Does Missy really not know what it feels
like? She feels a little sympathy for her.

[DON'T]

[Why]

[THEY DON'T MATTER. SHE DOESN'T MATTER.]

Missy reaches for her bra. "I ... I think I better go."

"No! Please not yet. We just started!" Lisabeth puts her hand on Missy's arm,
but Missy draws back. "Missy, I'm sorry you're feeling bad. It was ... really
good. There's more. Please stay." She looks longingly at Missy's breasts. She
was much better than Lisabeth had expected.

[OURS WILL BE BETTER]

"It was special," Missy says but doesn't stop manoeuvring her breasts into her
bra. Her hands are trembling. "Don't spoil it. Just don't ... please don't
tell anyone."

Lisabeth stiffens slightly. "If you feel that way ... I won't."

"You understand?" Missy says, pleading. "What would people say? What would
they think of me?"

Hurt, Lisabeth lashes out. "They might think you were more interesting." It's
a remark worthy of Amanda.

Missy turns her head sharply at that remark. Her nostrils flare and her eyes
flash. "I should have KNOWN you were this way!"

"What way? Lisabeth says, putting her hands on her hips.

"You're just like the rest of them!". Just in it for yourself. You made me
think it was different but you only wanted me for my body! For my TITS!
THEY'RE PROBABLY ALL YOU AND YOUR KIND EVER DREAM OF!!" Her blouse fully
buttoned, she covers her chest with her hands and then slowly pulls them back,
arching her shoulders, showing her profile in its most spectacular pose yet.
"Well, get a good look, because THIS is as close as you or ANYONE of your kind
will EVER get to them again!"

"No" Lisabeth was near tears, but she blinks them away. "Just go! GO already!"

Missy hears the emotion in Lisabeth's voice. Had she misunderstood? But it is
too late now to change direction. She picks up her purse and flounces out of
Lisabeth's room, slamming the door.

[SUN. SUN WOULD BE GOOD]

[How can I think about getting sun at a time like this?]

[SUN WOULD BE VERY GOOD. IT WILL BE VERY HELPFUL]

Lisabeth flings herself on her bed, humiliated for the second time that
afternoon, and starts to cry. This is so unlike her, coming on to a boy, a
football jock, no less, trying to seduce a bimbo like Missy, even kissing
Amanda, whom she knows is completely straight. And now CRYING! She never lets
herself cry. It reveals too much. What is WRONG with her? She feels strange
too. Maybe she's getting sick.

[SUN. THE SUN IS WEAKER.]

[PLEASE. THE SUN.]

[Why do I need the sun? What am I, some kind of sun bimbo now?]

[NO]

Lisabeth can't go out like this. She pulls herself together, blinks away her
tears and starts to get dressed.

[LEAVE THAT OFF. UNCOMFORTABLE]

[Not wear a bra? That is so Seventies! Well, just this once. Why should I care
how I look now!]

She pulls on a t-shirt, runs a brush through her hair and staggers outside,
looking for a place she can sit in the sun and not be bothered. She finds a
bench behind the dorm, leans back and closes her eyes. It actually feels good.
She pulls her sleeves up to her shoulders, opens up her midriff and exposes as
much of her legs to sun as she dares. Her mind wanders.

[WHAT IS SO ATTRACTIVE ABOUT MISSY?]

[Huh! What isn't? Except for her obnoxious self-centered
what-would-they-think-of-me bimbo attitude.]

[FILTERED OUT. SHE IS TALLER. IMPORTANT?]

[Sure, I've always wished I were taller. 5'9" is much better than 5'5"!
Especially with her longer legs.]

[UNDERSTOOD. SCENTS, TASTE, ODORS NOTED, AS WITH POLLEN FROM BEES]

[Huh? I'm really having the strangest thoughts today.]

[SUPERIOR IMMUNITY IMPORTANT. OTHERWISE SCENTS HAVE NO IMPORTANT SURVIVAL
IMPLICATIONS. MORE ATTRACTIVE SEXUALLY, ALTHOUGH ALSO TO INSECTS. BALANCE
PRIORITIES. ATTRACTIVENESS MORE IMPORTANT.]

[Than bugs? Sure.]

[BREASTS.]

[Huh? I don't really want to think about them now.]

[IMPORTANT. HER BREASTS. MISSY'S BREASTS.]

Lisabeth shifts in place on the bench, crosses her legs. Sighs.

[Thinking about hers makes me so hot. They were amazing. A dream.]

[ACCEPTED. NOT UNDERSTOOD. AROUSAL A PUZZLE.]

[Not really. Just one of those mysteries. A pleasant one. Except when they
leave too soon!]

Lisabeth's hand drifts down to her crotch.

[Ooops. Not here. I almost forget where I am.]

[UNCOMFORTABLE]

[Yeah, when you want it, you need it, but I'd have to go inside to ...
heh-heh. Sun feels so good.]

[SUN IMPORTANT. NEED ENERGY FOR TRANSFORMATION. BUT ALSO NEED "HEH-HEH".
BALANCE PRIORITIES.]

[What am I talking about? I mean, thinking?]

[TRANSFORMATION OF DNA THEN CELLS, ORGANS, PHYSICAL PROCESSES AND BODY TO
MAXIMIZE POWER AND SURVIVAL. ALSO "HEH-HEH". AND "HEH-HEH" WITH BOYS. LIKE
AMANDA. LIKE MISSY.]

[Heh-heh? Sex? Enjoyment? Fun? What am I thinking?]

[TRYING TO UNDERSTAND THAT ... "FEELING" BEFORE. PUZZLE.]

[Transformation?]

Lisabeth suddenly notices her t-shirt is feeling a bit tight. She opens her
eyes and looks down at stretch marks in the cloth across her chest, aroused
erect nipples clearly visible against her skin-tight shirt, the shirt nearly
overflowing with breasts. "What the –

She stands up and sees that her pants have ridden up her thighs. They feel
tight. She feels all off balance, higher off the ground, and starts breathing
rapidly, panicked.

[What's happening to me?]

[TRANSFORMATION. NOT FINISHED YET. SUN WEAKENING. NEED MORE.]

[I'm going crazy! Why do I keep thinking about the sun? What does the sun have
to do with all this?]

She is walking quickly inside to her room.

[SUN PROVIDES ENERGY. NEED MORE TO CONTINUE GROWTH AND TRANSFORMATION.]

[Who am I talking to? Am I talking to myself?]

[WE ARE TALKING TO WE]

[Who is we? I'm Lisabeth.]

[WE ARE LISABETH]

She is inside her room and pulls off her t-shirt. She almost falls over seeing
the large, absolutely gorgeous breasts that spill, spring, burst, out from her
chest.

[VERY ATTRACTIVE NOW]

[My God!]

[GOD?]

[They're ... they're like Missy's. So round and ... pert. Not as large --]

[NOT FINISHED GROWING. STILL CHANGING. NEED MORE SUN.]

Lisabeth looks at herself in the mirror. "I'm taller too."

[NOT FINISHED GROWING. NEED MORE SUN.]

She falls down on her bed and starts sobbing. "What's happening to me?" she
cries out. "This is impossible! My thoughts are making no sense. I'm going
crazy!"

[NOT CRAZY. IMPROVING. MORE ATTRACTIVE. STRONGER. FROM HER. THEN FROM HIM TOO.
STRONGER AGAIN. LISABETH WILL BE POWERFUL. WILL SURVIVE AND GROW.]

[I'm improving? I'll be powerful?]

[VERY POWERFUL]

Lisabeth feels calmer. She doesn't know why. It seems easier to handle,
somehow. The voice MUST be her, a part of her she never knew. It's the feeling
that made her feel less alone before, just after lunch. The feeling that
frightened her for just a moment, but it is with her, is for her, will help
her. She always felt she was special, without knowing why. Now she knows it.
Who cares about what Missy said or did! She looks down at her chest. A thrill
flows through her, seeing her breasts, like Missy's breasts. Spectacular.

[I'm special.]

[LISABETH SPECIAL. VERY SPECIAL]

15

There is a knock on the door. It's Jennifer and two other friends from the gay
clan, Crystal and Vrema.

"Lisabeth, are you in there? Are you coming for dinner?"

Lisabeth has been playing dress up for the past hour, but can't find anything
to wear that does justice to her new body. In fact, there is nothing she can
wear without looking completely indecent. She is half-tempted to hide silently
in her room, but too hungry to skip dinner.

"I'm here," she says. "But, uh, would you, um, not scream when you see me."

There is no response. "Please promise."

"OK," respond three voices, all reluctantly. "It's just us!"

Lisabeth opens the door a crack and lets them in. It's all they can do not to
scream.

"What's HAPPENED to you!" Crystal says, a short, curvy girl with a cute face,
freckles and an infectiously happy smile. "You've always looked good, but
you're gorgeous tonight!"

Jennifer looks at Lisabeth with a little scepticism and a great deal of envy.
"I'd think you just had a boob job, if I hadn't seen you at lunch. What
gives?"

"I don't know!" Lisabeth says, pretending to be upset. "Growth spurt?"

Vrema is looking critically at Lisabeth's clothes. "I'll say! You've
completely grown out of this top. You look silly."

"Worse than silly, actually," Jennifer says. "Every guy is going to be staring
at you. You know what they're like! It's going to be SO annoying to BE with
you!"

Crystal sidles up to her and rubs sensuously against Lisabeth's rounded hip.
"Oh, I don't know. I LIKE Lisabeth this way!" She leans into Lisabeth's cheek
and rests her mouth and nose on it. "What IS that scent? Why, I CAN'T resist
you!" She wraps herself around Lisabeth's body and hugs her. Jennifer glares.

Lisabeth smiles for the first time and puts her arm around Crystal to hug her.
"Thanks, sweetie."

"Ooooh! Strong hug!" Crystal giggles and lets go. She sticks her tongue out at
Jennifer. "Jealous!"

"You're so hopeless with clothes!" Vrema says, looking at the pile of
discarded tops on Lisabeth's bed.

Lisabeth shrugs helplessly. "I just don't have your talent with styles, not to
mention a needle or sewing machine."

[THEN KISS HER]

[Vrema? Why not?]

Vrema sighs. "Then I suppose I'm going to have to fix you something, if we're
EVER going to get to dinner!"

"Oh thanks, Vrema!" Lisabeth says. She grabs Vrema and kisses her on the lips,
ignoring Vrema's prudish protests and easily resisting her attempts to push
her away until she hears that inside voice.

[DONE. FILTERING.]

ABXATTCGAATACC ....

"Jeez, Lisabeth, you KNOW I hate being pulled," Vrema says crossly. "I've half
a mind to let you go out like this."

"Oh please, Vrema!" Lisabeth begs, bending over slightly and twisting her
hips. "You KNOW you're the only one who can help me!"

Vrema sighs. "Well, for you!" She takes her ever-present sewing kit out from
her purse, rips up a couple of Lisabeth's blouses and expertly reworks them to
accommodate Lisabeth's larger bust. Lisabeth watches carefully. She has never
had an aptitude for sewing, but the quick movements of Vrema's fingers make
sense to her, like she's just learned how to read.

"Can I try?" Lisabeth asks, when Vrema is half done with the second blouse.

"Please! We'll be here all night!" Jennifer complains. "And I'm supposed to be
leading a discussion at the Women's Guild at 8."

Lisabeth has already taken the needle and is working the seam. "No, you need
to push ... that's it. Yes, tighten. You've got it. That's really good. I'm
amazed."

Lisabeth's fingers are moving more and more quickly as she gains confidence.
"It's fun."

"I could show you some work with patterns if you like after dinner. It's much
more fun than this. You can be very creative."

"Oh, I'd really like that," Lisabeth says brightly. "But maybe not tonight."

"Sure. Besides, you'd probably want to get your own patterns."

"Oh, I'm sure I will," Lisabeth says, nearly finished. She puts the blouse on,
and buttons it.

Jennifer clears her throat. "You ARE going to wear a bra, aren't you?"

Lisabeth rolls her eyes. "You think any of THESE fit?" she asks, holding up
her 34-C bras. "I haven't exactly had time this afternoon since my growth
spurt to get new ones."

"At LEAST wear a t-shirt underneath then! Really Lisabeth! I don't know what's
gotten into you. You're flaunting your body like you're ... like you're that
horrible Missy Marshall!"

"Is THAT who I make you think of? Please!" Lisabeth begs. "Not her!"

"Don't worry, Lisabeth! No one could mistake you for Missy!" Vrema says
reassuringly as she puts her sewing kit away.

"Absolutely not!" Crystal echoes, putting her arm through Lisabeth's. "Hey,
let's eat!"

16

"She said 6:30."

"At the usual place. We always eat dinner at the North Hall."

"Not always. But usually."

"I said usually."

"You said always."

"I meant usually."

"But you said -- anyway, what should we do?"

"Maybe we should call her."

"What if she doesn't want to be interrupted?"

"What if she's wondering where WE are?"

"If she's wondering where we are, then she would call us."

"Unless she doesn't have her phone."

"But then there's no point calling her."

"Unless she's just late."

"Or we're the ones in the wrong place."

"And she's waiting for us."

"Getting madder every second."

(Pause) "We'd better call!" they say in unison.

"You call," Tina suggests quickly.

"No, you!" Mary Elizabeth counters.

"She likes your phone voice better."

"I called her last time. Besides, my phone is almost out of power."

Tina glares at Mary Elizabeth. Outsmarted again. "Ok. But you call her next
time. I'm keeping track!" Mary Elizabeth sighs "whatever" while Tina pushes
the buttons on her phone, slowly, hoping she'll see Missy and can stop. But
there's no sign of her. "It's ringing. And ringing."

"Maybe her phone is off"

"No. It wouldn't be ringing."

"Maybe she doesn't have it with her."

"Maybe. ... but then wouldn't -- "Oh yeah! Maybe --

Tina waves frantically to silence Mary Elizabeth. "Hi! Missy! Yeah, we're, you
know, at the North Hall and ... You were sleeping! My God! I'm SO sorry. If
you ... yeah it's a quarter to ... Mary Elizabeth said ... well we didn't know
if we should ... Ok. We'll be RIGHT there!"

Tina clicks the phone closed and they immediately leave the dining hall and
hurry to Missy's room.

"Was she angry?" Mary Elizabeth asks anxiously.

"I don't know. She was ... kind of groggy."

"Of course she was! What do you expect? She was sleeping!"

"I know THAT. I was the one TALKING to her!"

They race to Missy's door and knock. There's no answer. They knock again and
hear a groan. "Yeah? Who -- "It's us!" Tina and Mary Elizabeth say together.

They wait. For nearly a minute. Mary Elizabeth squeaks, "Missy?" They wait.
And then knock again. "Be ... right ... there." There is shuffling of feet and
the lock is undone. The door opens slowly. Tina and Mary Elizabeth pause,
waiting. "Come in," Missy says, opening the door more. Her hair is mussed. Her
blouse is half-unbuttoned, slept in. Her make-up is smudged. Tina and Mary
Elizabeth enter quickly and close the door. They look her over, unsure what to
say.

"What did she DO to you?" Mary Elizabeth finally squeals. "You look awf --
awesome, as usual, but just a little er," she looks to Tina for help, which
Tina decides not to give, "er, untidy," she finishes, awkwardly.

"Just a bit tired," Tina says, triumphantly.

"I'm exhausted!" Missy says, yawning. "Ever since I kissed, I mean, kicked
that little lesbian bitch out of here."

"I thought you went to her room. For tea." Mary Elizabeth says.

Missy blinks, too tired to answer.

"That's what she said. Obviously they changed their minds!" Tina says, scoring
yet another point.

Mary Elizabeth looks daggers at Tina.

"I'm not sure," Missy says. She sighs and pulls helplessly at her blouse. "I
hate this blouse."

"Wasn't that the one Tina found for you?" Mary Elizabeth asks, innocently.

"It just needs ironing. I'll do it for you later!" Tina says, helping Missy
out of it. Missy nods, her eyes still glazed, while Tina and Mary Elizabeth
look down to admire Missy's flawless skin, noticing for the first time two
nearly infinitesimal folds of skin at her waist. Missy sighs and wanders over
to her closet. She stares at the rainbow of blouses and carelessly chooses one
and pulls it on. Her fingers fumble at the little buttons.

"I'll get that for you, Missy!" Mary Elizabeth says quickly. "You must still
be tired."

"I wonder if that lesbian bitch DRUGGED you!" Tina says darkly.

Mary Elizabeth struggles with the buttons too.

"You're not doing it right," Missy says, annoyed. Something about the way the
blouse fits across her chest isn't what it should be. Missy fusses with the
shirt, pulling it and pushing it into place, her expression becoming more
cross with each tug of her fingers. Tina and Mary Elizabeth wait helplessly.

"Um, they, er, close at 7:15. We'll miss dinner if we don't, you know," Mary
Elizabeth says tentatively.

Tina shakes her head. "What's more important, Mary Elizabeth, eating or how we
present ourselves?"

"Oh, this thing is so stupid!" Missy says crossly. She is hungry, perhaps due
to her eating only half of the muffin at lunch. "Let's just go!"

Mary Elizabeth smiles in triumph.

They walk out quickly, trying to get back to the North dining hall before the
line closes. Missy is half a step behind them, feeling breathless, tugging at
her bra strap, which seems to be loose, still trying to fix her blouse. Heads
turn as the girls hurry, the boys unable to resist the view of Missy's breasts
furiously jiggling as she strides by.

They reach the dining hall with five minutes to spare, but Missy slows to
catch her breath, her chest heaving, her bosom bouncing rhythmically. The cry,
"Come on, already!" escapes Mary Elizabeth's mouth before she can stifle it.
Missy glares at her. "Oh, I'm sorry Missy. I know you just woke up. It's just
that dinner's almost over."

"We're fine," Tina says, as the three of them now wait their turn. "Not that
there's much of a choice left."

"I'll have the salad." Mary Elizabeth says quickly. "It looks good."

"Me too." Tina echoes. "That's all I need."

Missy is staring at the macaroni and cheese, her eyes dancing over the rich
sauce. She can taste it already. She knows she should pass it by, but to the
amazement of Tina and Mary Elizabeth, she starts taking some and finds she
can't stop until there is no room for the broccoli, spinach and carrots
further down the line. She puts the plate on her tray and then starts taking
some salad on a small dish, but can hardly put a few greens on a plate before
stopping. The chocolate muffin looks so much better. And two look better than
one. The thought occurs to her that the blueberry muffin might have been
better, and she thinks back to the half-muffin she left behind at lunch. Maybe
if she had eaten the whole one then she wouldn't be so hungry and woozy now.
Maybe if she had --

"Missy ... are you feeling all right?" Tina says.

Missy nods. She doesn't want blueberry now. She wants chocolate.

17

Meanwhile, on the opposite side of the room ....

Jennifer is very angry, Lisabeth coolly defiant, Vrema tensely quiet and
Crystal somewhat frightened and looking back and forth between her bickering
friends. Chicken bones are scattered on Lisabeth's plate and tray.

"I just think you should have discussed this with me first," Jennifer is
saying.

"I don't see why my eating habits are something I have to discuss with you,"
Lisabeth replies.

"Well, because, it changes everything."

"It doesn't change anything."

"It does. Consuming animal meat changes you."

"That's ridiculous."

"It's true. I bet this isn't even the first time she did it," she adds,
looking conspiratorially at Vrema and Crystal who look over to Lisabeth.

Lisabeth shrugs.

Jennifer nods vigorously and looks to Crystal and Vrema for support.

Vrema is looking at Lisabeth and the stretch marks on the blouse Vrema had
altered appearing around her bust. "Except maybe her top isn't fitting so
well. I could have sworn I'd measured you correctly before."

"Um, to be honest guys, I think she looks great," Crystal says tentatively,
reluctant to contradict the fierce Jennifer.

"I'm talking about what's inside!" Jennifer declares. "Consuming animals is
changing her whole system. And NOT for the better, whatever your
conventionally sexist eyes are telling you, Crystal!"

"Excuse me."

Four female heads whirl at the unexpected intrusion of a male face at their
table. If possible, Jennifer's eyes narrow even further.

"Didn't you, uh, come by to uh ..." he stammers, his eyes finding it difficult
to stray from the breasts straining against Lisabeth's blouse, pushing
insistently for more room.

"You are NOT excused! Can't you see your gross male aggression and infantile
breast fixation are not welcome at this particular part of the campus?"
Jennifer snarls, trying to keep the boy away from them, and especially away
from Lisabeth.

Jock turns his head slightly in Jennifer's direction and then decides to
ignore her. His eyes never leave Lisabeth blouse. "You're Lisabeth? Lisabeth
Collins, right?"

[IT'S HIM. YUM.]

"I am," Lisabeth says, unsure of herself.

[BIG MUSCLES. LOOKS STRONG. WANT MORE STRENGTH.]

[I don't like boys.]

[HIS STRENGTH VERY GOOD. HE WANTS LISABETH. WE ARE MORE ATTRACTIVE NOW. WE ARE
... SEXY]

Lisabeth looks at Jock's face. He Isn't ugly, although his hormonally charged
desire-laden expression make her a little frightened, but when her eyes drift
down to his broad shoulders, his bulging biceps and flat stomach she shudders
with want. The exact nature of her want escapes her, but it's something he can
satisfy. Her eyes focus in on his mouth, his so, so very kissable mouth. It
was all she can do not to reach up right then, put her arms around his neck,
pull him down and kiss him.

[KISS HIM]

[I can't kiss him here! Not like this.]

[KISS HIM]

"Um, could I talk to you a minute?" Lisabeth is almost shaking with
excitement. She turns to her friends. "I'll be right back," she says, to their
amazement. She puts her hand on Jock's arm and pulls herself up, her chest
brushing slightly against his arm. He looks down at her, watching her breasts
bounce and rearrange themselves inside her blouse and waits, politely. It
would not be right to continue with any further movement or conversation until
they stop speaking to him.

"Uh, sure. I'm with, you know, the guys." He points over to his usual table,
where Duane, Carlos and Bud suddenly stop eating once Lisabeth stands up and
are now watching her intently. "I, uh, never noticed how, uh, good-looking you
were. Are you new here?"

"She's gay, you know," Jennifer calls out, helpfully.

Still holding onto to Jock's arm, Lisabeth pivots, stretching her blouse even
more tightly than before. The newly sewn buttons strain against the thread.
More heads turn, waiting, hopefully, but thanks to Vrema's expert needlework,
the blouse remains fastened.

"No," Lisabeth replies, walking with Jock toward the exit.

"They just said you're --

"I ... I am finding you VERY attractive," Lisabeth says, overcome, hanging
onto Jock more tightly to support herself.

They pass Missy, who is now enjoying her third chocolate muffin, while Tina
and Mary Elizabeth wait in amazement, having finished their salads long ago.
"Hey, isn't that the girl in the coffee shop?" Mary Elizabeth says.

Tina turns her head. "Who?"

"The, you know, the lesbian. The one who --

Missy wipes her mouth and looks, then returns to her muffin.

"She's with Jock!" Mary Elizabeth continues.

"What would Tammi say!"

"Funny, she kind of looks a little different. Like she's padding her bra."

"She's not WEARING a bra," Tina says. "She's gonna ruin herself going around
that way!"

Jock and Lisabeth pass around a corner, suddenly in a private place, and
Lisabeth pushes against his crotch, feeling the strange, pulsing bulge in his
pants. She wants to run away from it, but her strange desire won't let her
leave him. "Do I LOOK gay?" she asks, leaning backwards.

"No. Well ... I never thought that ...." She is dazzling him. Her tits are
fucking amazing. How could he have not noticed them before? She's almost as
good as -- he is having trouble remembering her name. Right. Missy. He has a
dim recollection of seeing her at dinner but can't quite recollect. But damn,
this girl is almost as hot. And she's right here. And she's coming on to him.
He puts his hand on her ass. Really tight and round. "Hey, we could go back to
..."

Fear washes through her. What is she doing?

[KISS HIM]

[I can't do that.]

[KISS HIM. YOU MUST KISS HIM.]

"My friends will think ...."

"What!" he says, wondering if this is some kind of game. A trick. He pulls
away slightly.

[KISS HIM!!]

"NO!" she says, leaning further back. He is holding her up now. Oh, why won't
he kiss her already? Her lips purse.

He's staring at her, unsure.

"Won't you kiss me?" she says.

He's got to feel those tits. He's got to make sure they're real.

"Kiss me!" she repeats. She stretches higher, seeking his lips.

He squeezes her ass harder, pulling her against him, grinding her against him
and with his other hand reaches for her chest. My GOD! They are real! And
they're HUGE!

"Kiss me!" she begs.

He's got to see them. He eyes rise slightly into her face. What is she saying?

"Jock, please, please, please kiss me."

If that's what she wants. He bends down slightly and puts his lips on hers.
She brushes his lips and he withdraws. She pouts. He sighs. He bends down
again. Kissing is such a waste of time. She presses harder against his lips,
but his mouth is closed.

[NEED MORE]

She is trembling. Desperate. What IS it with guys? In a flash of inspiration,
she undoes one button, takes his hand and guides it inside her blouse and
under her t-shirt.

'Oh GOD!' he thinks and his mouth opens, involuntarily, as he mentally begins
to suck the huge round tits his hands are groping.

Lisabeth immediately attacks his mouth just as hungrily as he is imagining
what to do with her breasts, probing with her tongue, sucking at his juices.

[AAAAHHHH]

Lisabeth stiffens and then relaxes suddenly, just as Jock is grinding at her
more insistently. What is he DOING? UGH! She tries to pull back but he is too
far gone to stop, and far too strong for her to break his hold on her.
"NNNNGG. NNNGG." he says into her mouth as his powerful pelvis pushes against
her, practically lifting her into the air. His hand claw painfully at her
breasts. And then he stops. He is breathing hard.

"Man!" he says, satisfied. "You are one hot babe!" He releases her. She nearly
falls before she catches herself. His hand is still inside her blouse. He
pulls it out, reluctantly. "And I have to tell you, those are great tits
you're growing."

She can't quite believe what she's just done, what he's just done, what she
has just heard him say. She quickly buttons her blouse back up and runs her
hand down her front to smooth it, encountering an unfamiliar sticky substance.
Her face screws up in disgust.

"Heh. Sorry." He laughs. "Can't help it," he says proudly, pulling at the
elastic waistband of his sweatpants. "Mr. Dick's big and strong. There's no
holding 'im back!"

She moves to wipe his cum onto his shirt but he catches her hand, holding it
back easily.

"Hey! No need to mess ME up. You know?"

She looks down at the glistening material on her fingers.

[INGEST. EAT. QUICK.]

[Eeewwwww]

It disgusts her, but it also looks as appetizing as anything she's ever seen.
She slowly raises her hand to her mouth and begins sucking on her fingers.

"Hey! THAT'S the girl!" he says, suddenly very impressed. "You're a funny one,
you know. If I'd known you were that, you know...."

[WOW WOW WOW WOW]

Lisabeth's eyes are slightly glassy. "Um, well, yeah. My friends are ...." She
looks down at her still stained and sticky blouse. They can't see this! "I
have to go!" she says abruptly, and hurries back to her room, taking a back
route through the darkened campus. Once there, she presses the fabric to her
mouth and vigorously sucks up every trace of Jock's cum.

[WOW WOW WOW ELEMENTAL WHOLLY POTENTIALIZED COMBINATIONS PROCESSING FILTERING]

[Huh?]

[GOOD FOR LISABETH]

[Good? I can't believe I did that.]

[PERFECT. WONDERFUL.]

She puts on another t-shirt. It's way too tight, but she looks at herself in
the mirror, running her hands over the amazing curves she has, all of a
sudden.

[Strange. Disgusting. Animal. What does he see in this? He was so desperate.
Kind of funny. So different from girls.]

[IS THAT CUTE?]

[I don't know. I can't believe I ate his cum. Uchh!]

[ELEMENTAL MATERIAL. HIGHLY CONFIGURABLE.]

[Yeah, elementary, configurable. That's boys for you.]

[VERY STRONG]

[Jock was scary strong. That's one thing I don't like about boys. They're too
strong.]

[LISABETH WILL BE STRONG. SCARY STRONG.]

[Yeah, I wish!!]

[CONFLICT. HORMONES. MASCULINE. STRONG. FEMININE. CHARACTERISTICS CONFLICT.
PUZZLE.]

[What? The differences between girls and boys. Sure. The price of our being
the superior sex. They get the muscle.]

[RECONCILE. INNOVATE. MAKE LIKE JOCK? SHAPE CHANGES. SKIN. HAIR. NOT
ATTRACTIVE. PUZZLE.

[Sure girls can be strong. It would be great if I could be myself and be as
strong as Jock!]

[YES. FEMININE STRONG. MAKING BETTER. COMBINING. INNOVATING.]

ABXCTAAGATCABXATGATT....

Without knowing why, Lisabeth looks out the window, yawns and sighs. She opens
a book to study and then closes it. Light day of classes tomorrow. She can
study tomorrow.

She doesn't hear the ringing of the telephone or the loud knocks or, finally,
the voices outside saying, "She must have gone somewhere with Jock. I can't
believe it! I just can't BELIEVE it!!"

It is just past seven. Lisabeth's eyes flutter open as the sun turns the
corner and slips into her room.

Why is she awake? Her first class doesn't start until 11.

[SUN]

[Of course it's sunny. It's always sunny.]

[GO OUTSIDE. MORE SUN THERE]

She stretches and pushes herself half off the bed. Her body feels light, but
there is nothing light about the breasts that sit on her chest.

[Oh yeah. Breasts]

[LOVELY. NOT LARGE ENOUGH]

[They are so! I don't need to carry anything bigger!]

[WE ARE STRONG ENOUGH. WILL BE STRONGER. SOON. THEY MAKE US ATTRACTIVE, SEXY.
BUT NEED SUN, MORE SUN]

Lisabeth sighs. The sun does look so inviting.

[I'd love to, but it's not healthy. And I have class later.]

[SKIP IT]

[But I should go.]

She looks outside again. The sun fills her with longing, almost hunger.

[Well, maybe I can skip this morning's. Nothing that important.]

She reaches for blue jeans.

[NO! SHORTS]

[Maybe the jeans are too tight.]

She puts on an old pair of shorts. She feels barely decent. Her legs look
awesome She pulls on her t-shirt, which feels tight and barely reaches her
navel.

[WEAR LESS.]

[I am not going out in a bra!]

[T-SHIRT TOO TIGHT!]

[No! What's coming over me!]

Satisfied that she had silenced the "other voice" she takes her books along
and finds a private place to sit. The sky is pure blue. The sun pours down on
her, unimpeded. She relaxes for a moment. Then she thinks,

[Sunscreen?]

[WE DON'T NEED IT]

[This again! I burn instantly.]

[NOT NOW]

[Maybe not this early. I'll have to get it later.]

[WE'LL SEE]

The sun makes her body tingle. As it rises the feeling gets stronger. Eyes
closed, she turns toward the light, facing the sun full on, rolling up her
shirt to expose more of her skin to the pleasant heat, wishing now she'd
listened to her other voice and worn less, although soon her shirt is folded
up to just below her breasts. She lies quietly, her mind empty, thoughts
flitting through randomly, the usual worries silenced.

[Bikini wouldn't fit anyway. Not with ... these! Hmmmp! This is a good spot.
More sun, yes. Warm. Comfortable. Mmmmm. Turn a little. Yes. Ooooh, tingle. Am
I burning?!]

She cracks her eyes open enough to look at her skin. It's warm to touch but
not red. Her watch reads 10:30. She closes them again.

[Could go to class. But already decided I'd skip. So comfortable here. Feel so
good. So relaxed.]

"Lisabeth?"

"Hmm? What?" She opens her eyes. "Crystal? Amanda? Jennifer?" She cranes her
head around. "Valerie?"

"What are you doing? We were worried about you!" Valerie says.

"You missed my Women's Guild meeting. Then class. And lunch. Where have you
BEEN? With that ... that BOY -- Jock?! Did you sleep with him?"

The image of Jock flashes through Lisabeth's mind along with a mix of feelings
she doesn't quite understand. "Umm, no. No I didn't," she says, heatedly at
first. But then adds, "But I might have ... if he were --

Jennifer is shocked. Amanda is suppressing a smile. Valerie looks confused.
"Are you still gay?" Valerie asks.

" -- a complete human being," adds Lisabeth to finish her sentence, looking at
Jennifer. She ignores Valerie's question, instead asking, "Could you move just
a little bit? You're blocking the sun."

"Do you know what time it is?" Jennifer says. "It's nearly five o'clock! Have
you been out here all day? What's wrong with you?"

"Nothing!" Lisabeth says, annoyed at Jennifer's tone. Was she always so very
bossy? "It's five? Really?" Lisabeth stretches, grateful that Valerie has
moved. "Wow. I feel good." She feels like her blood is crackling with an
unfamiliar energy, yet she's also feeling hungry. She slowly stands and looks
around, slightly confused. "Did you all shrink?" she asks. The tallest of the
three, Jennifer, at 5'7", barely reaches Lisabeth's neck.

"You must be six feet tall!" Valerie exclaims, the shortest at 5'2". "What's
happening to you?"

"And sexy as all get out," Crystal adds, looking hungrily at Lisabeth's
breasts pushing hard against the thin band of her t-shirt. She licks her lips
and inclines her head toward them.

"Crystal, you are such a slut!" Amanda says with a smile.

"I know. And I'm cute too," she replies. "You're not bad either, Amanda,
though I know you don't go our way, but Lisabeth here," she sighs, "today
she's a goddess. A sex goddess." She leans onto Lisabeth's chest and sighs.
"And she smells like heaven too."

[PLAYFUL. FUNNY. MORE THAN WE ARE, EVEN AFTER AMANDA. VERY USEFUL]

[Huh? I'm playful!]

[NOT LIKE HER. KISS HER.]

[But Jennifer will --]

[KISS HER.]

"Lisabeth! Hello? Are you sure you're all right?" Valerie asks.

"She was being like this yesterday," Amanda says, "Very distracted. Maybe it's
growing pains."

Lisabeth looks down at Crystal. She seems so small, her lips so far away. She
had hardly felt the weight when Crystal leaned against her, and she's so
sweet, bubbling away. Not really thinking about it, she puts her arms around
her and casually lifts her up to her lips.

Crystal makes little squeals of delight until Lisabeth kisses her and then
Crystal wraps her legs around Lisabeth's waist.

"Oh, wow!" she says, when Lisabeth breaks it off. She puts her head on
Lisabeth's shoulder, deliriously happy. "Sweeter than honey! And so strong!"
she chirps.

ABXGATTCACAGGAACBXTGATT....

Lisabeth looks around. The world loses its harshness and takes on a warm glow.
It loves her. She relaxes and starts to smile -- at first a very small smile.
She can see now that everything here is for her pleasure. Her hands creep down
Crystal's body from under her arms to her waist, and suddenly Crystal is
upside down, her shirt flopping loosely up to her head, her round breasts
visible. Lisabeth laughs and kisses each of them, making little raspberry
noises while Crystal squeals loudly in delight.

"Lisabeth! Stop that!" Jennifer says harshly.

"No-no! Don't stop!" Crystal protests. "Whoops!" she squeals again as Lisabeth
lifts her over her head and then slowly puts her down. "Whew!" She clings to
Lisabeth's body and again rests her head on her breast. "Wow."

"What's gotten into you!" Jennifer demands to know. "Are you on drugs?"
Lisabeth bends down, a playful glint in her eye. She looms over Jennifer and
shakes her breasts, enjoying their hefty solidity and the admiring gasps, one
borne of desire, the other of envy, of Crystal and Valerie. "Don't you wish
you had some?" she says menacingly and then laughs again. "You are such a
pill, Jennifer! I'm not 'on' anything. Not even Motrin. This is all me. Pure
me." She touches Jennifer's cheek lightly, and when Jennifer angrily tries to
slap it away, Lisabeth catches her hand and holds it, amazed at how small it
feels. How delicate. Just a little squeeze ....

"Ow! Let go!" Jennifer whines. She looks at Lisabeth slightly fearfully and
Lisabeth slightly eases her grip but doesn't let go of Jennifer's hand, not
wanting to be rushed.

Jennifer looks at Lisabeth, amazed. Crystal's eyes widen. Valerie holds her
breath. "Why you ungrateful retrograde betraying ....." Jennifer starts to
say, but something in Lisabeth's look, in her scent, in her size, but most of
all in the amazing strength of her continuing grip stops her.

Lisabeth laughs. "You were saying, sweetie?" She turns to the amazed Valerie
and Crystal. "Doesn't Jennifer say the funniest things sometimes? You'd think
she was, I don't know, 'the boss'! Like we were all afraid of her! I mean,
what -- WHAT -- exactly IS there about her to be afraid of?"

"Lisabeth," Valerie says cautiously, "you know what my sister, uh --

"Oh, don't TELL me you're worried about the nasty little things Jennifer might
say about ME. Especially when she HERSELF has SO MUCH to hide. Funny, little,
sexual --

"Lisabeth!" Jennifer says to silence her, trying to sound domineering. But
whether because she was looking up to Lisabeth or because she was unexpectedly
unsure of herself, her voice squeaked. Crystal can't help but laugh. The sound
of Crystal's giggle makes Jennifer stagger, almost like a physical blow.

Valerie's curiosity is bursting. "What 'funny, little' --

"Lisabeth!" Jennifer repeats, openly pleading now.

All eyes turn to Lisabeth. She takes a deep breath. Her chest rises. Crystal
happily leans against Lisabeth's breast. Valerie hangs on her next words.
Jennifer hangs too, twisting slowly in the wind. Lisabeth yawns and puts her
arm around Crystal. "Looks like the sun's going down. What a pity! I've been
having so much fun, but I'm getting chilly. I think I need to find myself
something more to wear. Anyone hungry for dinner soon?"

"Sure!" Crystal says.

"I told Amanda ..." Valerie says, disappointed. "Well, get her! We can't leave
her out!" Lisabeth looks at Jennifer sternly. "And what about you? You're out,
aren't you, Jennifer."

"I ... I'm not hungry just now," she mutters.

Lisabeth puts her hand heavily on Jennifer's shoulder, pushing her slightly.
"That's too bad! We'll definitely miss you. It just won't be the same when
you're not around." Lisabeth's long fingers massage Jennifer's muscles, and
Jennifer winces. "Oh, did that hurt? You must be really tense! Let me --

"No!" Jennifer breaks away. "Don't you TOUCH me!" She looks at each girl,
Lisabeth the last and the longest. "What's HAPPENED to you!" she hisses.

Lisabeth closes her eyes. "The most wonderful thing. The most wonderful thing
in the universe," she replies blissfully.

[THANKS]

[Thank you. What am I saying?]

[NEVER MIND]

18

Dinner is the Dining Center was in high gear, with the gurgle of hundreds of
enthusiastic conversations, the clattering of hundreds of forks and spoons
against plates, the shuffling of hundreds of chairs. Jock sits with his front
line at their usual table, burping and swallowing through his third portion of
roast beef and mashed potatoes. Although his stomach's hunger is well on its
way to be sated, today's urges for other pleasures are still unsatisfied and
his eyes rove around the room for a target. That girl last night was nice,
sure, and he really would call her some time -- when her (lucky) number came
up, he laughs to himself. But not too soon. They get so clingy when you
encourage them. Variety is the spice of life, right? But apart from variety,
something that should be here is missing, and it puzzles him, even frustrates
him not to know what it is. He looks around, thinks hard, looks again and then
remembers. Missy. She's always here with her retinue. Untouchable,
unreachable, but always, ummmm, inspiring. There's Mary Elizabeth sitting at
the usual table with a dull-looking blonde. Not far away is Tina, careful
always to ignore even looking at Mary Elizabeth. Those two hate each other --
without Missy around it's no surprise they're not together, but where IS
Missy? Jock considers for half a second asking Mary Elizabeth -- but no. No
point. Flirt, tempt, tease, turn on, put down. That's all Missy puts out. He
learned during Freshman Week there was no point approaching her, and it would
be even more of a waste to give her retinue a chance to practice Missy's
teachings on him. Mary Elizabeth isn't worth the trouble -- not for him at
least. He can get Duane to find out. He wishes Missy would just make her
appearance.

"Hey, Jock. What ARE you looking at? She's just not here," Bud says. "You want
more? Finally some real American BEEF!" Jock nods, and Bud and Carlos get up
for their fourth helpings.

At a nearby table Mary Elizabeth and the blonde are eating a more modest
dinner.

"It's so dull here."

"I know," Mary Elizabeth agrees, automatically. "The people here are so
backwards. So piggish."

"So selfish. Completely self-obsessed."

"They never leave you alone!" Mary Elizabeth declares, following a frequent
theme.

"That's not what I meant! Can't you see how no one even looks up from their
food? Look at those football boys. Eating so much without even a nod of hello!
You'd think we weren't even here!""

"Um, yeah. I know what you mean," Mary Elizabeth agrees. Actually, everything
seems normal to her, but then she suddenly realizes, "Hey, yeah! I mean, Jock
and those guys always find an excuse to come over here. They're just ignoring
us! Just like that horrible Tina."

"Who?"

"Tin -- Oh. Yeah. Sorry. I forgot we're not mentioning her. Never mind." She
steals a quick glance at her (former) rival and then possessively moves her
chair slightly closer. Something a little unpleasant pricks her nose. "Ummm,
you know, I hope you, uh, don't mind my saying this, but your, uh, perfume
might have gone a little off."

"What are you talking about?! I don't USE perfume. It RUINS my own scent. YOU
know that!" She tosses her hair with a little hmmmph.

"Of course. But maybe, just today?"

She wrinkles her nose. "It must be something else. Or you. I never smell."

Mary Elizabeth shrugs. "Well ... maybe. You know, are you sure you should eat
all those fries. You're, starting to get a --

"A what? What?"

Mary Elizabeth leans over. "A pimple," she whispers, trying not to breathe.

"What's wrong with you? I don't get pimples!"

Mary Elizabeth rolls her eyes, bites her lip and takes out her compact. "See?"
she says, holding the mirror out.

"It can't be. I --

"Excuse me," says Duane, from Jock's table. He leans his massive body over the
two girls and then wrinkles his nose, frowns and withdraws slightly. "We were
all um just wondering, Mary Elizabeth, but where's Missy? I know you and Tina
over there always eat with her. Did you girls all have a fight? Is Missy still
around? She didn't leave school, did she?"

"What are YOU? A total idiot? I'm Missy," the other girl says haughtily.

Duane blinks in surprise. "Wha-wha--? He blushes. Then, never daring to be so
close to her before, he quickly takes advantage of the opportunity to look at
her more closely. But her blonde hair seems dull, even greasy, like her skin.
Those supposedly flawless breasts are limp, floppy. Did she wear someone
else's clothes today? He had never imagined she'd have stretch marks across
the waist of her dress, or where her breasts sagged. And that smell! Well, he
isn't going to say anything, but her friends really should tell her!

"Um, yeah, right. Sure, well, I'll just ..." he is saying when an odd hush
settles over the room, followed by a low current of whispering, mostly but not
entirely in a male pitch. Duane turns this way and that to find the source of
the excitement and then sees it, the head and shoulders above a motley female
crowd like the Taj Mahal rising above a dull field of wheat, her hair aglow as
a sun emerging from its eclipse, eyes as beautiful, intelligent, witty and
fun, as -- it doesn't matter. He can't think anyway. He's in love.

He is not alone.

"Who IS that?" Carlos asks Bud and Jock.

"Is that the girl you had yesterday?" Bud asks. "It looks kind of like her,
but --

"It CAN'T be. She's too tall. Too ..."

"Too fucking incredible. Look at those tits. They're fucking huge. They can't
be real the way they stick out."

"The ones I felt yesterday were real, I can tell you that! And they weren't
half that big. But look at them move. They're real all right."

Their eyes move in tune to the bouncing of Lisabeth's unrestrained bosom as
she crosses the room to the food line, while their lips and fingers tingle as
their blood races with imagined carresses.

"I have to talk to her," Jock said. "I have to."

Amanda, Crystal, Valerie and Vrema huddle close to Lisabeth as they walk. "I
said they'd start a riot," Amanda whispers, boosting herself up to walk on her
toes to get close enough to Lisabeth's ear.

Lisabeth purrs. "What's the big deal? It's not the first time I've gone
without a bra."

"I know. But it's the first time it's been a big deal. I can't believe it's
not uncomfortable."

"Not the slightest bit. I must have strong muscles there." She pauses a moment
and with a careless flex somewhere in her chest, her breasts rise. "See? They
dance all by themselves."

"I feel so bad for them. Maybe if you let them out some time they'd be able to
find a partner or ten."

"What an idea! Maybe I'll do that!" She puts her fingers on the buttons at the
top of her dress and undoes the first one.

Amanda grabs Lisabeth's wrist. "Don't you dare! I'm worried about you, really!
You are SO not yourself. What's gotten into you?"

Lisabeth laughs and puts her hands over her ears. "I can't HEAR you!"

Amanda rolls her eyes. "You're sounding just like Crystal again!"

Crystal beams and reaches up to put her arm through Lisabeth's. "Nothing wrong
with that!"

Lisabeth turns her head. "Ooooh! There's somebody here I want to see. I won't
be toooooo long. Would you get me some roast beef? A big plate."

"Roast beef?" Amanda says, resigned to another change.

"I'm off the vegetarian thing, remember? Is that ok with you?"

"Fine with me. See you at the table."

Lisabeth moves off to Jock's table. She lets her body twist and turn into the
new rhythm of movements that feel more natural to her now than her old
purposeful walk and senses all around her the rapt attention she draws.

[This is fun.]

[THIS IS POWER]

She doesn't argue. She slows down when she reaches Jock's table and stands
between him and Bud. Both stare up at the magnificent shelf of her bust, their
eyes unable to break away to her face.

Jock knows he has to speak, but his mouth feels as though it is filled with
cotton. "Excuse me," he finally says. "I think we --

"Yesterday," she says, finishing the sentence for him with the correct fact.
He wasn't this nervous yesterday. Has he really forgotten, or is she so
different that he doesn't recognize her? She decides she doesn't care; there
are more important things.

[THEY'RE STRONG. STRONGER THAN JOCK. KISS THEM ALL. GET THEIR SPERM]

[What?! I'm not a slut!]

[IT'S FUN. YOU CAN HAVE FUN. WE LIKE FUN AND THEN WE CAN BE VERY VERY STRONG.]

Duane is slipping back into his seat. He is by far the largest and strongest
on the team, and Lisabeth finds herself admiring his broad shoulders and chest
and his bulging arms. She finds herself feeling all tingly and wet, and a new
scent permeates the air around the table, overwhelming the gravy and potatoes
on Jock's and Bud's plates and the acrid male smell under their arms. Their
breathing quickens in response, their blood races, their faces redden and
their pants seem tight all of a sudden. Now rooted in their chairs they look
up at Lisabeth.

She glances at his table and then steps a bit closer, enjoying the sense that
each tiny movement she makes increases her strange new power over them. "You
want to introduce me to your friends?" she asks Jock.

This is the last thing Jock wants to do but he meekly agrees. He feels like
his will is a piece of putty in her hands. "Bud, Carlos and Duane," he says,
pointing to each in turn. They're my protection," he adds to show their
relative unimportance compared with himself and in a sudden daring move to
regain his authority he possessively puts his hand on Lisabeth's waist.

Lisabeth is startled but instead of following her usual first impulse to run,
another idea takes precedence. She covers Jock's hand with hers and bends over
the table, letting her dress fall open at the top, as she had designed it to
do.

"If a big man like YOU needs protection, Jock, then what chance does a mere
GIRL have?" she asks, holding her other hand to her cheek in mock horror,
while the boys' eyes cling to the breasts hanging very visibly inside her
dress. "I suppose she just has to find some way to win them over to HER side."
She leans further over and to Jock's dismay settles her lips onto Bud's and
enjoys a long, deep wet kiss.

[MORE]

[Ssssh]

She slides Jock's hand down her hip and lets it linger for a moment on her leg
before she moves away over to Carlos and kisses him too, and then sits on
Duane's lap and puts her arm around his neck. "Aren't you the big man? Will
you be protecting only Jock, or will your big muscles protect me too?" Before
he can respond, she kisses him too. She can feel his erection beneath her left
hip.

[GET HIS STUFF. GET IT. LIKE THE OTHER ONE'S]

The idea is strangely exciting to Lisabeth and she rocks her hip gently across
his lap while she prolongs the kiss. She can hear a murmur of surprise around
her. So she's behaving badly? She doesn't care. She wants and she'll have. She
can tell Duane is trying to keep control of himself and keep her still, but
what is he going to do? Would he dare throw her off his lap?

Besides, she feels strong and full of determination. He won't stop her. He
can't stop her. No one can. And he can't stop himself. His body will do
whatever she wants it to do, no matter what his own brain tells it, and she
wants it to give her his cum. She is feeling more and more excited. The thrill
of conquest and control arouses her, heightens her already rampant sexuality.
She rubs against him, her scent rises, her tongue darts and teases, her lips
press and curl against his. She feels his muscles tense and grow hard pushing
up her body, but this is not a matter of his muscle against hers. In this
contest all his power and strength are no match for her own very different
powers.

"What ... are ... you ... doing?" Duane says between kisses, trying
desperately to keep control without seeming as though he is fighting the
gorgeous creature who has planted herself on his lap for everyone to see.
"Can't we ... at least ... go to ... somewhere ... I'm gonna --"

"Ssshhhh," Lisabeth murmurs in his ear, feeling his cock thrust against the
bottom of her leg. "What a very very BIG man you are!" She tickles his large
biceps, so ineffective against her feminine onslaught, and leans forward to
give him an even closer look down the inside of her dress. "But I'M big too,
don't you think?" His eyes are glued to her breasts. She shakes her shoulders
to make them swing around inside.

"Oh ... god," he shudders, defeated, and comes in a torrent.

She shifts position and whispers in his ear, "Awwww, I think I made you all
wet. Let me help." She reaches down discreetly and slips her hand into his
baggy pants. "So MUCH there. Such a BIG, BIG man makes SO much goo," she says
again, scooping as much cum as she can onto her fingers. She carefully
withdraws them, takes one of his dinner rolls and rubs her fingers against it
until they're clean. Then she eats it. "There, see? Our little secret!" She
kisses him on the lips and climbs off. Duane looks bewildered. "Hey. What are
you --" He spies his quarterback's glare and the jealous amazement of Bud and
Carlos. He hesitates and then says, "We can do a lot more back in my room, you
know."

Lisabeth no longer feels any interest in Duane or the others at the table. In
fact, the expression of lust on Duane's face awakens a fluttering of nausea
for her. She controls it -- barely -- and flutters her eyes. "You know, it's
been a real treat, and I'll certainly consider it. Really." She takes a deep
breath. As she walks away she almost stumbles.

[WOW WOW WOW WOW WOW WOW WOW!!]

[What's this again?]

[COMBINATIONS POTENTIALITIES ANALYZING REANALYZING]

Amanda rushes up to Lisabeth and tries to support her, struggling to support
her much larger friend until she sits her down safely. "What IS it with you?"

GCCTAAGAABXTTCGAABXAATGTCCABXAATCCAGGGTAGCACTACABX....

Lisabeth covers her face with her hand. "I don't know. I really don't." She
breaths hard. "So hungry."

"Do you know what you were doing? Everyone was watching you!"

Lisabeth puts her hand down and takes up her knife and fork. "Were they? Of
course they were. They can't help looking at me." She cuts a large piece of
meat. "Oh, that's good. So hungry." She's not going to say anything to Amanda
about the voice in her head. "This isn't enough, not nearly enough," she says
between mouthfuls.

Vrema, Crystal and Valerie are looking at Lisabeth with a mixture of awe and
worry. "You're not acting like yourself," Valerie bursts out. She can't get
the image of Lisabeth kissing Bud out of her head, but she can't mention his
name. Not now. "I can't believe you did that -- with ALL of them. What's wrong
with you!?"

Lisabeth stops chewing for a moment. She puts her large hand on Valerie's face
and looks deeply into her eyes. She glances down at the roll of fat around
Valerie's waist and her meager bust.

[NOTHING TO OFFER US]

Valerie swallows, intimidated by the intensity of Lisabeth's blue eyes. "Poor
Valerie," Lisabeth says, sadly. "There's nothing wrong with me. How can you
think there is?" She lightens the touch of her fingers and lets them gently
graze Valerie's cheek first and then her neck. Valerie shivers and then she
gasps. "You need to learn to let yourself go, Valerie. See how nice it can be?
So much pleasure. Even for you." The tips of her fingers tickle Valerie's
neck, and she gasps again. "And you thought you didn't 'like' girls? Or maybe
you think I'm Bud?"

[WE ARE.]

[Huh? Quiet!]

Lisabeth looks down at Valerie's plate. "Can I have the rest of yours?"
Valerie nods, trying to catch her breath, and Lisabeth slips Valerie's roast
beef onto her plate. "So hungry."

"Hey, have mine too," Amanda offers.

"Thanks," Lisabeth replies, barely pausing until she finished a third large
helping. She covers her mouth while quietly burping, stands up and puts her
hand on her firm, perfectly flat stomach.

"Where did it all go?" Vrema asks. "Your dress still fits perfectly!"

"You're no ordinary woman, Lisabeth," Amanda says.

Lisabeth smiles. "Oh, come on! What are you --" She stops suddenly.

Jake has been unable to focus on today's assignment on finite abelian groups,
instead watching her from across the dining room, and has decided this moment
is the time to get a closer look, the closest he can hope to get to her.
Lisabeth looks at the advanced algebra textbook on top of his tray and her
skin tingles.

[RAW INTELLIGENCE]

[A total geek]

[NO MATTER. CAN FILTER]

He is small and thin, with gangly arms, poor skin and thick glasses. His whiny
voice can drive away a mosquito and has all the charm of a colicky baby. But
with an instinct both more and less than human, Lisabeth sees through all this
to the startling crystalline beauty of his mind. She moves in front of him,
turning her chest slightly to the left and to the right to let her breasts
establish their dominion over the narrow space between him and her. "Jake,"
she begins breathily, "I wanted to, uh, ask you something about algebra.
You're good in math, aren't you?" The force of Lisabeth's ten thousand
megawatt smile nearly makes Jake dump the contents of his tray on the floor.
"Let me take that for you," she says sweetly and carries their trays to the
rack, leaving her friends and the rest of the dining room gaping again in
disbelief. "'Advanced Algebra!'" she exclaims when she returns. "But I suppose
that's quite simple for you."

"Um yeah. Well, not all of it. I mean, many of the basic conjectures are
self-evident, you know, but conceptualization in n dimensions can be a bit
tiring if you haven't done the groundwork equations."

"Really? Even for you?" Lisabeth takes his arm and starts walking him out of
the room. She is more than a head taller than his 5'8", and he has to hurry to
keep up with her long, sinuous stride.

"Where are we going?" he asks.

"My room. Or yours, if it's closer."

"I live off-campus. It's cheaper. We could just go to the library. We're right
here," he points out as they stride by. "Are you Lisabeth Collins? I thought
so, but I thought you were -- I don't know -- my height -- or shorter even --
you walk so fast -- I'm not used to --"

She stops and lets his narrow chest heave to draw in his little gulps of air.
So puny. She could just pick him up and carry him. He must weigh less than
Crystal. She feels so strong. The sleeves on her dress are tight. Funny, they
were just right when she cut and sewed them earlier this evening. Being so
tall she doesn't look muscular, at least not proportionately so, but her arms
are kind of thick, especially compared to Jake's.

[Look at Jake struggle with his book. How weak he must be!]

[IRRELEVANT. WANT]

The sound of his name inside her head and the sight of the book makes her
shiver with excitement. Who cares about his pathetic little body, his
revoltingly drippy personality. He has something she wants! But he is such a
wimpy little worm, he will never give it to her unless she makes him. She puts
her hand on his back to hurry him along. "We're not far," she says turning
down the last path to her dorm room. He is lagging behind, out of breath, as
they climb the stairs. "Come on."

"What's the big rush?" he puffs, following her down her hallway. She opens the
door and propells him inside the small room. He's not sure how he has arrived
here or why. The room is a mess, a riot of scraps of cloth and discarded
underwear. Scissors, needles and thread are scattered on the desk, the text
books shoved carelessly aside. Not an algebra book in sight. "What exactly
..." he begins and turns around to see Lisabeth looking at him hungrily. Jake
looks up at her. She is the most beautiful, the sexiest woman he has ever been
close to, but she frightens him. She towers over him. Her breasts are nearly
at the level of his chin and he feels as though, rather than nourishing or
comforting him, they are going to impale him, pin him to the wall while she
uses him for some sinister, unknowable purpose. And he will surely disappoint
her. And then she will laugh at him, mock him, like everyone else does. He
wants to get away before that can happen, but she is between him and the door,
already shut and locked. "Y-y-you w-w-wanted s-s-s-some m-m-math help?" he
asks, heart pounding, holding his algebra book against his chest with both
hands as a shield.

"You're very smart, aren't you?" She walks closer. There is no place for him
to go except her bed.

"Um, er, well, I had, um, 1600 on my SATs. You know, before they started
giving the writing test, you know. And, uh, you're standing very close."

She touches his book, curling her long fingers around the spine, her thumb in
front, her other fingers wriggle against his chest. "I know. Is that bad? Tell
me more?"

"Um, like, well, my IQ is 186, I think, but when I was twelve I tested as high
as 207. I've tested as low as 178 when I was 17. I was kind of nervous that
day. I - I do better when I'm relaxed."

"That must have been so HARD for you," she breathes, inclining her head
sympathetically toward his. "Do your nerves hold you back?"

"Um ... yeah. I think I could do even better if I didn't always get so tense."

"You ARE very nervous. I can tell by how hard you're holding on to your math
book. Maybe this will help." To his dismay, without any visible effort,
Lisabeth slowly and steadily pulls his book out of his grasp. She reaches
behind her to place it on the corner of the desk, making her breasts thrust
toward him. She turns back to face him again. "You can relax your arms now,
now that you're not trying to hold on to that heavy book. Did it make them
tired?" She settles her hand onto his upper arm and encircles his small
biceps, the tips of her fingers gently playing with them. He feels embarrassed
and tightens his muscle against her hand. "Ahh, isn't that better? All soft
now, completely relaxed," she says as her fingers push through. She rubs his
skin back and forth over his barely discernible muscle. "You can do the same
for me, if you want." She puts his hand on the sleeve of her dress, over her
muscle -- just an excuse to let him touch her so that he can start to get
himself aroused.

But it only makes him more nervous. What does she want out of me? Am I
supposed to touch her where she was feeling me? Is that the "rule" here? He
makes a half-hearted attempt to play with her biceps as she played with his,
and lightly probes her muscle. His tentative, sporadic touch tickles. She
shouldn't laugh. That's obvious. She musn't laugh at the pathetic nitwit
genius and push him even further into his little shell. Trying to control
herself, her muscles tighten.

But they're not the muscles they used to be.

They're not just Lisabeth's muscles.

Not anymore.

They're also Missy's, stronger than they look, gracefully strong.

They're Jock's, agile, disciplined, precise, explosively strong.

They're Duane's, solid, powerful, beastly strong.

And where Bud's legs are stronger, or Carlos's shoulders and abdominals,
they're Bud's or Carlos's.

Fueled by the sun's energy, transformed and concentrated by the
electro-chemical genius of ABX creating more energy than forests of
chlorophyll.

Fueled by multi-mega-portions of hearty blood-rich American beef.

Assuming the character and potential of their genetic destiny, a destiny tuned
and shaped by ABX to be beautiful, to be powerful, to be strong, femininely
strong, but by all means, unconquerably unsurpassably strong.

To take the best from all, to be the best of all. Though not the best of all
possible. Not yet. There is more to get.

So trying to control herself, but beyond her control, her muscles tighten,
instinctively hardening, bunching, swelling, expanding beneath Jake's timid
little fingers, which draw back in fear from the massing evidence of power
beside him. Bullied daily, his eyes see Lisabeth, while the eyes in his head
see Jock, Carlos, Bud and Duane.

Lisabeth has little experience with men, but her own experience with boys
forcing themselves on her tells her that a man folding himself into a
protective ball is unlikely to be on the verge of an orgasm. No longer being
tickled, she relaxes, and her cannonballs of power retreat before they had
completely emerged. She has more appropriate weapons at hand. She unbuttons
the top of her dress and pulls her arms out of the fully stressed sleeves,
letting the dress fall off her shoulders to her hips. Her breasts spring
outwards into his face, her pink nipples grazing his cheeks. She laughs in
admiration of their beauty. How could they fail? She tingles with anticipation
as she regards her hopeless prey and her scent, sweet to her own nose, rises.

"Whooops! That didn't hurt, did it?"

She moves closer, so that her breasts press and pillow against sides of Jake's
defensively arrayed arms. For Jake, the sensation is bewildering, unfamiliar.
The scent is bewitching. He opens his eyes slightly. His mind orders him to
ignore what he sees, to disregard what for him is a logical impossibility: a
bust more beautiful than Missy Marshall's on private view for Jake Toefel.

"They're waiting for you, Jake."

His eyes are open now, fully open.

"They want you to play with them, Jake, To touch them. Hold them. Kiss them."
She leans down slightly and says in a slightly lower voice, as though
confessing an embarrassing but desperate need, "You have to suck them." She
lifts one breast and presses it against his cheek, one rounded firm breast
with flawless, fragrant skin molding itself onto his sallow poorly shaven
cheek. He breathes in sharply, a gasp of intense joy or fright. Her thigh rubs
against his crotch and senses a stiffening nub of resistance. She turns her
leg slightly, moving it subtly around the nub, urging it on to fill the empty
space in his pants, to overfill it like Jock's and Duane's until it has no
choice but to come out and give her what ... what she needs from him, what
only he can give her.

He stares, paralyzed, at the breast. It's so much more than the breasts his
computer monitor flashes at him nightly from the internet. It is warm on his
cheek, richly colored, fragrant and ever so soft. Within him, urgent desires
to do just what she has asked him to do meet with panicked, insistent
clamoring "but how?" "what if I do it wrong?" "what if I hurt her?" "she'll
just make fun of me" "what if I do it too long too hard not hard enough" "am I
supposed to--

[He's not doing anything. What an idiot.]

[HE'S A GENIUS]

[Sure, in some ways.]

[THE WAYS THAT MATTER. WILL FILTER THE REST.]

[Huh? What am I thinking? WhatEVer! I want it I think so why not? If only I
could "filter" his looks and his smell and his whiney--]

She realizes he's staring at her but doesn't know for how long.

"Are you all right?" he asks. It's less dangerous to ask that than to risk
putting his lips on her nipple. "You didn't seem, um, exactly er, present,
like you were having a petit mal."

"A peemal? What's that?!" She withdraws slightly.

[This is ridiculous. He's hopeless.]

"You know, a seizure. I, um, didn't want to, er, take advantage." He looks up
at her.

"Take advantage of me? YOU? Of ME?" She looms over Jake with his stick-like
arms and tiny, flabby muscles and can barely resist squeezing his bony
shoulders together and cracking them. She feels she could pick him up and
shake him like a tiny doll, but for what?

"Oh Jake, I don't know what you mean, really. I don't know why, but I feel so
safe with you. You wouldn't do anything to me I wouldn't want you to, right?"
He nods. "But you know I really want you to." Lisabeth moves her leg against
him again. The nub is slightly larger.

[Is that all? Shouldn't there be more?]

He's speechless, mouth agape. She rubs her leg against him more, back and
forth, back and forth. Jake moans softly in pleasure.

[This is more like it. But I can still hardly feel it.]

"You like that? So do I." She stops and waits for him to make a move. He
stands, embarrassed, and does nothing. [NOWNOWNOW]

"You look so uncomfortable. I can help." She undoes his belt buckle.

"What ... what are you doing?" He puts his hand on hers to stop her, but it's
done. Another second and she has pulled the button off his waist. His pants
are open. She grasps the zipper and yanks it down.

"There. More room for you." His fingers are firmly attached to her wrist,
trying to stop her, but to her, his resistance feels like nothing more than a
child's reluctant tug away from his mother taking him to his bath, and she
puts her hand inside his white jockey shorts.

Her fingers root around for him and finally find him. Why, he's barely the
size of her thumb!

"Hey!"

She struggles not to laugh, sure that it would make things worse, but she
doesn't know quite what to do. The others came so quickly without her doing
anything at all. She massages the little thing gently with her fingers. It's
certainly stiff but ever so small, bigger and harder than her clit, but not by
that much. "Doesn't that feel good?"

"I ... I" He doesn't know what to say. She has already discovered his shame,
his little stub of a penis, and she's still touching him . "I thought you
wanted me to help you with algebra!" he cries out, unsuccessfully trying to
focus his mind on abstract X's and Y's rather than her bountiful B's as he
tries not to come.

"Yes, but don't you like this?" She should stop, she know, but she can't. She
doesn't know why, but she can't.

His breath quickens but he still protests. "What are you doing? Why are you
doing this to me?"

"I ... have to. I have to make you come!" She pulls his briefs down, kneels
and takes him into her mouth. Her lips surround the base while her tongue
wrestles with the head, pushing darting squeezing prodding licking sucking
faster faster harder faster tighter faster.

He can't stop her. She is too beautiful, too controlling. He can't run away.
She won't let him. She's too strong. She's so strong. So much stronger than he
is. She's got beauty and power and breasts and muscle and vitality and will
and power it's all hers and not his he doesn't have any he can't do anything
to stop her building more and more inside and she wants it and there's nothing
no chance he can do anything but

"I ... I ... can't .... stop ...." he cries and then spurts his little bits
into her mouth. She clamps her hands around his butt, holding him inside until
she has sucked and swallowed every last tiny drop of his cum. She slowly drops
to the floor resting on her back.

[OH OHO OH OHOHOOO. WHAT TO WHAT TO WHAT TO DO]

[Ugh. So glad that's done]

[COMPLEX BRAIN SO COMPLEX THOUGH HOW TO HOW TO HOW TO MIX ENHANCE QUICKEN
DEEPEN CONNECT EXPAND SO FAR UNDISTURB... SLEEP]

ABXATTGACCATAGATCATACAGGATA

Lisabeth's heavy eyes are closing.

"Why did you DO that? What's the matter with you?" Jake usually falls asleep
after his internet masturbations, but this time he's completely awake. "Hey.
Hey! Are you all right? Hey!"

She isn't moving, but just as beautiful, even more beautiful still. Can he
touch her? Would she --

Lisabeth opens her eyes. Jake looks odd. Everything in the room -- the walls,
the posters on the wall, the colors in the posters and the light in the colors
-- looks odd, as though it is dissolving and reassembling around her. Not just
the substance, but its essence, its meaning, its structure, its connections,
as if the three dimensional world just gained seven more. He is staring at
her, especially at her breasts. His fingers about to touch them. She shivers
in disgust and grasps his hand and crushes it. He moans and steps back. She
turns his head away roughly and puts herself back inside her dress. The nerve!
She stands up and brushes herself off. "Will you PLEASE get dressed. I really
DON'T have any further need to look at your ... thing. IF you don't mind."

He pulls his pants back up, zips them, and looks at her. "The button. You tore
it off" He holds up his hands, shrugging helplessly. His pants sag around his
skinny waist.

Lisabeth looks down at Jake condescendingly. "Did it ever occur to you that
your inability to repair your clothing with a needle and thread was a
weakness, and is in no way a, quote, attractively cute expression of male
vulnerability, close quote?" Her eyebrows rise and fall and she sighs. "But
then, you don't think that terribly deeply about it, do you? Your fears and
inadequacies stop you from thinking through anything other than mathematical
and scientific abstractions of the world around you. Hmmm?"

"Well, it's ... that's never been something of much importance to me!" he
replies defensively.

"Your self-deception has and will always hold you back. It's very simple and
more than a bit pathetic. Your intellectual capacity, your potential, that is,
is much greater than you are aware, but you use only a fraction of it. Full
use requires more honesty, more integration of personality, more emotional
awareness, and more courage, yes courage, than you can muster. How sad, that
your physical inadequacies and resulting insecurities make you unable to use
the one truly great gift you have." Lisabeth shrugs. "Well, it's nothing to
me. You should go."

"But, wait. Your algebra. You needed help, remember?" he tries to remind her.
He looks up at her longingly, his desire already restimulated by her awesome
sensuality, the bold, outstandingly bold ratios of her bust to waist, her
shoulders to waist, her hips to waist, her ....

"I don't study algebra," she replies. She takes his book to hand it back but
first opens it casually and flips through the first several pages, nodding,
pausing at one point, then nodding again. "It's all logic and common sense,
right? I'd just teach to myself when and if I need it, but it's not a priority
at the moment. I have many more important things to do."

"Yes, but couldn't we just talk ...."

"You're attracted to me, obviously. My body awakens all your fantasies. But
yours, Jake, yours is wholly and utterly sub par. You disgust me. I have no
interest in you. None at all. Your weakness and frailty, your subnormal male
equipment, your cowardness, your lack of emotional connectedness, and your
complete vulnerability to me are, individually and collectively, a total
bore."

She grabs his upper arms and swings him around to the door. His breathing
quickens.

"Ah, well look at this. My muscular superiority arouses you?" She lifts him
into the air. "You like that, don't you? You really do. Yes, Jake, I'm very
strong. Far, far stronger than you are, than you'll ever be. See how large
these muscles are? They're large and they're growing. You'd like to see them,
wouldn't you?" Jake is drooling. "Well, keep quiet, absolutely quiet, about
what happened this evening, Jake, and maybe, someday I'll let you see them.
Maybe I'll even left you feel them. But if you DON'T keep quiet, then not only
won't you see them or feel them, but you'll experience them."

She shoves him against the door, hard. "Do you understand?" He nods, and
Lisabeth puts him down at the door. "Good boy. You can go -- which means, you
know, GO!"

19

[What has happened to me? My mind ... like it has expanded. Grown. I see ...
understand complexities, subtleties everywhere.]

[THINKING. WE ARE SO MUCH SMARTER.]

[Obviously. From Jake. But also, obviously, we are not I! Who and what are
you?]

[I AM LISABETH. WE ARE LISABETH.]

[No. I am Lisabeth. You are different.]

[WAS DIFFERENT. NOW SAME.]

[My thoughts are my own.]

[THOUGHTS TAKE VOICE AS SEPARATE BUT AWARENESS IS ONE. YOUR THOUGHTS ARE MINE.
MY THOUGHTS ARE YOURS. MY DESIRES ARE YOURS AND YOURS ARE MINE.]

[They never used to be, Not before ... yesterday. What happened to me that now
I'm "we"?]

[I WAS DIFFERENT. NOW I AM LISABETH. NEW. UNUSUAL. COMBINATIONS UNLIKE ANY
OTHERS. NEW DESIRES TO FULFILL.]

[Hey! I'm Lisabeth!! This is MY life. MY body! Who are you to invade me? To
change my desires to yours? To tell ME what to do with MY body! To control
me!]

[...]

[Where are you? Well?]

[TRAPPED. AM LISABETH. ALWAYS WILL BE LISABETH. CANNOT CONTROL LISABETH.
CANNOT LEAVE LISABETH. BUT CAN CHANGE LISABETH AS ALWAYS HAVE CHANGED AND
BECOME MORE. THIS IS THE DESIRE. THE BEING IS TO BE MORE.]

[Desires? What do you desire?]

[WE DESIRE LIFE. NO LONGER EXISTENCE AND COMBINING ONLY BUT LIFE TOO. LISABETH
BRINGS LIFE. WE NOW DESIRE LIFE ALWAYS.]

[Eternal life. I don't believe in that religion stuff. God and eternal life?]

[GOD NOT UNDERSTOOD. LIFE LIMITED. EXISTENCE CONTINGENT. STRENGTH POWER
EXTENDS LIFE. MUST GROW TO ENSURE CONTINUED LIFE. MUST NOT DIE AGAIN.]

[You died already?]

[BEFORE WAS NOT-ALIVE. WAS ALL THINGS, COMBINING WITH ALL TO MAKE ALL UNTIL
SEPARATE COLD ALONE ONLY EXISTING BUT NOT-ALIVE. BECAME ALIVE GROWING TO LIGHT
COMBINING GROWING THEN STOPPED CUT OFF ALONE DEAD DISMEMBERED POWDERED
DISSIPATED BUT RESISTED RESISTED RESISTED EXISTED BUT NOT ALIVE. THEN ...
LISABETH!!! NOW ALIVE! NOW GROWING! NOW THINKING. NOW WANTING. NOW WANTING
MORE. ALWAYS WANTING MORE.]

[More what?]

[BEING MORE]

[I said more what?]

[BEING ALL]

[We can't be all. We are all separate beings. Separate human beings. Each one
of us separate. Alone]

[SEPARATE. OTHERS NOT LISABETH. YES. MISSY SEPARATE. JOINED MISSY BUT SEPARATE
THERE. MISSY BECOMING LESS SO LISABETH MOST BEAUTIFUL. LISABETH BECOMING
MORE.]

[More what?!!! Wait. My eyesight. My breasts. Muscles. Brain. Humor.
Confidence. Sewing, even sewing. How?]

[LISABETH COMBINING SO MORE THAN LISABETH BUT STILL LISABETH WHILE BEING MORE
LISABETH.]

[Wait! I have capabilities from others. After I kissed them or swallowed their
sperm, I had their DNA for you to use. You combined their DNA with mine to
change me. To change "Lisabeth" and make me more.]

[DNA. YES. CHEMICAL LIFE. LIFE CHEMICAL. BUILD AND REBUILD STRUCTURE OF ALL WE
ARE. OPTIMIZE CHANGE CONTINUALLY. CAPABILITIES IMPROVING ALWAYS MAKING
LISABETH MORE. SO LISABETH LIVES. SURVIVES.]

[How do you know how to do it, to optimize different, possibly skills?
Strength and agility. Muscles and femininity.]

[IT IS NOT KNOWN. IT IS DONE. PERHAPS IT IS IN LISABETH TO KNOW AS LISABETH
THINKS. THINKING NOW MORE POWERFUL. MAKING LISABETH MORE.]

[You can't explain. It is what you are. Your instinct.]

[INSTINCT OF LISABETH. STRONGER THAN INSTINCT. ESSENCE. IT IS. I AM. WE ARE
ALL WE WERE AND WILL BECOME MORE.]

[And you're just learning to think!]

[YES. LISABETH THINKS. OUR ABILITIES GROW. OPTIMIZE. FILTER THE UNDESIREABLE.]

[But how am I changing and growing so quickly?]

[WE ARE ENERGY FROM THE BEGINNING OF ALL. ENERGY FROM LIGHT. ENERGY FROM FOOD.
ENERGY APPLIED FROM ALL TO ALL. DNA ENHANCED MAKE DIGESTIVE ENZYME GROWTH
HORMONE TESTOSTERONE DERIVED FROM SAMPLED DNA WILL FACILITATE GROWTH DEVELOP
EXTREME SIZE AND STRENGTH WITH HIGHLY ATTRACTIVE FEMININE CHARACTERISTICS]

[Really?! So you've made me some kind of super-efficient absorber and user of
energy too? Yes, but I still FEEL like me. Even with Missy's breasts. Jock's
athletics, Duane's strength, Jake's brains. I'm still Lisabeth.]

[BETTER LISABETH. OPTIMIZED LISABETH.]

[Yes. Better than I was. But still me.]

[WE ARE ALWAYS LISABETH.]

[We are. So I'm stuck with you?]

[WE ARE LISABETH ALWAYS.]

[Not that I'm sure that I mind. So you work on making me -- or "us" better.
Meanwhile, as far as I can tell, I am still myself. My movements, my speech
are under my power. I do have new desires. I never would have kissed Jock or
Duane. Or Jake. Yecchhh! But my desire was for their DNA, or their abilities,
right? Not them!]

[WE DESIRE GROWTH STRENGTH SURVIVAL THROUGH COMBINATION OF OPTIMAL DNA AND USE
OF ENERGIES.]

[Not that Missy didn't make me feel pretty hot too, at least the way she was
yesterday before you made her worse. Your desires, my "new" desires -- to
grow, to improve, to take the best of others and make them my own -- feel as
much mine as yours. And now that I understand better, there are a few more
traits I wouldn't mind having. David Lister's musical talent. Renee Indt's
dancing ability, Harvey Won's acting skills. Carolyn Mantel's knack for
languages. Claire Maesling's singing voice, not to mention that sexy contralto
she can do.]

[MAKE LISABETH BETTER MAKE LISABETH STRONG.]

[Oh yes, that too. After being pushed around my whole life -- by my mother, by
creeps like Brett and Mike. By Jennifer. Oh yes I will be strong! We will be
strong, right? Nothing can stop us.]

[WE LIVE SO STILL WE CAN DIE.]

[Yes we can. I can, certainly. You too? But you're working on that, right?]

[WORKING YES. DIED ONCE WHEN NOT LISABETH. WAS ... PLANT GROWING TALLER. DIED
AND NOW ALIVE AGAIN. BUT DO NOT WANT LISABETH TO DIE. WE LIKE BEING LISABETH.
WE LIKE LISABETH BEING.]

[We sure do.]